EMAIL THIS PAGE TO A FRIEND

NPEPPS

aminopeptidase puromycin sensitive

142 Gene Product Result for
Synonyms: AAP-S MP100 PSA
UniProtKB ID: P55786, Q6P145, Q9NP16, Q9UEM2
Gene ID:
Human(9520) Summary: This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(19155) aminopeptidase puromycin sensitive
Rat(50558) aminopeptidase puromycin sensitive
domestic guinea pig(100723805) aminopeptidase puromycin sensitive
naked mole-rat(101726089) aminopeptidase puromycin sensitive
Domestic Rabbit(100350778) aminopeptidase puromycin sensitive
sheep(101122874) aminopeptidase puromycin sensitive
Zebrafish(407726) aminopeptidase puromycin sensitive
chicken(426231) aminopeptidase puromycin sensitive
cow(534122) aminopeptidase puromycin sensitive
Horse(100069104) aminopeptidase puromycin sensitive
domestic cat(101098097) aminopeptidase puromycin sensitive
dog(480538) aminopeptidase puromycin sensitive
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006310 Rosetta Predictions human pricing
NM_080395 Rosetta Predictions rat pricing
NM_008942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113597 predicted 1685
2 SASI_Hs01_00113598 predicted 2488
3 SASI_Hs01_00113599 predicted 1854
4 SASI_Hs01_00113600 predicted 2719
5 SASI_Hs01_00113601 predicted 1788
6 SASI_Hs01_00113602 predicted 645
7 SASI_Hs02_00341329 predicted 827
8 SASI_Hs01_00113603 predicted 2017
9 SASI_Hs01_00113604 predicted 2553
10 SASI_Hs02_00341330 predicted 942
11 SASI_Hs01_00113605 predicted 2613
12 SASI_Hs01_00113606 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267206 predicted 1170
2 SASI_Rn02_00267207 predicted 2583
3 SASI_Rn02_00267208 predicted 2322
4 SASI_Rn02_00267209 predicted 837
5 SASI_Rn02_00267210 predicted 850
6 SASI_Rn02_00267211 predicted 2392
7 SASI_Rn02_00267212 predicted 2332
8 SASI_Rn02_00267213 predicted 1731
9 SASI_Rn02_00267214 predicted 1540
10 SASI_Rn02_00267215 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314982 predicted 844
2 SASI_Mm02_00314983 predicted 1082
3 SASI_Mm02_00314984 predicted 1581
4 SASI_Mm02_00314985 predicted 493
5 SASI_Mm02_00314986 predicted 1838
6 SASI_Mm02_00314987 predicted 1221
7 SASI_Mm02_00314988 predicted 765
8 SASI_Mm02_00314989 predicted 860
9 SASI_Mm02_00314990 predicted 872
10 SASI_Mm02_00314991 predicted 776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008942
VALIDATED
NPEPPS MISSION shRNA Bacterial Glycerol Stock
aminopeptidase puromycin sensitive
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-3187s21c1
Sequence:CCGGCTCCTGTTAGTGACGGATATTCTCGAGAATATCCGTCACTAACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-2290s21c1
Sequence:CCGGAGAAGCCCGTCGTCGGTTTAACTCGAGTTAAACCGACGACGGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-700s21c1
Sequence:CCGGGCCTGCTATCAAAGCAACTTTCTCGAGAAAGTTGCTTTGATAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-2049s21c1
Sequence:CCGGTTGTGAATGAGCCCAATTATACTCGAGTATAATTGGGCTCATTCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008942.1-2882s1c1
Sequence:CCGGCCTGGGCCTCACTGCCTCTCTCTCGAGAGAGAGGCAGTGAGGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008942.1-687s1c1
Sequence:CCGGGCCTGCTATCAAAGCAACTTTCTCGAGAAAGTTGCTTTGATAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1894s1c1
Sequence:CCGGGCCATGCTCGAAAGTTTATTACTCGAGTAATAAACTTTCGAGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1444s1c1
Sequence:CCGGCGAATGCTACATGACTACATTCTCGAGAATGTAGTCATGTAGCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1073s1c1
Sequence:CCGGGCCTTGTTACTTATAGGGAAACTCGAGTTTCCCTATAAGTAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-402s21c1
Sequence:CCGGTGATGAATTGTGCTGATATTGCTCGAGCAATATCAGCACAATTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008942
VALIDATED
NPEPPS MISSION shRNA shRNA Plasmid DNA
aminopeptidase puromycin sensitive
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-3187s21c1
Sequence:CCGGCTCCTGTTAGTGACGGATATTCTCGAGAATATCCGTCACTAACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-2290s21c1
Sequence:CCGGAGAAGCCCGTCGTCGGTTTAACTCGAGTTAAACCGACGACGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-700s21c1
Sequence:CCGGGCCTGCTATCAAAGCAACTTTCTCGAGAAAGTTGCTTTGATAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-2049s21c1
Sequence:CCGGTTGTGAATGAGCCCAATTATACTCGAGTATAATTGGGCTCATTCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008942.1-2882s1c1
Sequence:CCGGCCTGGGCCTCACTGCCTCTCTCTCGAGAGAGAGGCAGTGAGGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008942.1-687s1c1
Sequence:CCGGGCCTGCTATCAAAGCAACTTTCTCGAGAAAGTTGCTTTGATAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1894s1c1
Sequence:CCGGGCCATGCTCGAAAGTTTATTACTCGAGTAATAAACTTTCGAGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1444s1c1
Sequence:CCGGCGAATGCTACATGACTACATTCTCGAGAATGTAGTCATGTAGCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1073s1c1
Sequence:CCGGGCCTTGTTACTTATAGGGAAACTCGAGTTTCCCTATAAGTAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-402s21c1
Sequence:CCGGTGATGAATTGTGCTGATATTGCTCGAGCAATATCAGCACAATTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008942
VALIDATED
NPEPPS MISSION shRNA Lentiviral Transduction Particles
aminopeptidase puromycin sensitive
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-3187s21c1
Sequence:CCGGCTCCTGTTAGTGACGGATATTCTCGAGAATATCCGTCACTAACAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-2290s21c1
Sequence:CCGGAGAAGCCCGTCGTCGGTTTAACTCGAGTTAAACCGACGACGGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-700s21c1
Sequence:CCGGGCCTGCTATCAAAGCAACTTTCTCGAGAAAGTTGCTTTGATAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-2049s21c1
Sequence:CCGGTTGTGAATGAGCCCAATTATACTCGAGTATAATTGGGCTCATTCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008942.1-2882s1c1
Sequence:CCGGCCTGGGCCTCACTGCCTCTCTCTCGAGAGAGAGGCAGTGAGGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008942.1-687s1c1
Sequence:CCGGGCCTGCTATCAAAGCAACTTTCTCGAGAAAGTTGCTTTGATAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1894s1c1
Sequence:CCGGGCCATGCTCGAAAGTTTATTACTCGAGTAATAAACTTTCGAGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1444s1c1
Sequence:CCGGCGAATGCTACATGACTACATTCTCGAGAATGTAGTCATGTAGCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008942.1-1073s1c1
Sequence:CCGGGCCTTGTTACTTATAGGGAAACTCGAGTTTCCCTATAAGTAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008942.2-402s21c1
Sequence:CCGGTGATGAATTGTGCTGATATTGCTCGAGCAATATCAGCACAATTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006310
VALIDATED
NPEPPS MISSION shRNA Bacterial Glycerol Stock
aminopeptidase puromycin sensitive
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2105s21c1
Sequence:CCGGGCTGGAATCATTAGCACTGTACTCGAGTACAGTGCTAATGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2151s21c1
Sequence:CCGGTTGTGAATGAGCCCAATTATACTCGAGTATAATTGGGCTCATTCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-1946s21c1
Sequence:CCGGCCAGACCAATGGGTGAAGTTACTCGAGTAACTTCACCCATTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2369s21c1
Sequence:CCGGGCAGGACATAAGGCAACGTTACTCGAGTAACGTTGCCTTATGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006310.3-3041s21c1
Sequence:CCGGTACCGAACAGCTGATTCATATCTCGAGATATGAATCAGCTGTTCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-3392s1c1
Sequence:CCGGCCAAGGATTGTAGTTTAGTTTCTCGAGAAACTAAACTACAATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1945s1c1
Sequence:CCGGGCTGGAATCATTAGCACTGTACTCGAGTACAGTGCTAATGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1786s1c1
Sequence:CCGGCCAGACCAATGGGTGAAGTTACTCGAGTAACTTCACCCATTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1792s1c1
Sequence:CCGGCAATGGGTGAAGTTAAACTTACTCGAGTAAGTTTAACTTCACCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-2209s1c1
Sequence:CCGGGCAGGACATAAGGCAACGTTACTCGAGTAACGTTGCCTTATGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006310
VALIDATED
NPEPPS MISSION shRNA shRNA Plasmid DNA
aminopeptidase puromycin sensitive
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2105s21c1
Sequence:CCGGGCTGGAATCATTAGCACTGTACTCGAGTACAGTGCTAATGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2151s21c1
Sequence:CCGGTTGTGAATGAGCCCAATTATACTCGAGTATAATTGGGCTCATTCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-1946s21c1
Sequence:CCGGCCAGACCAATGGGTGAAGTTACTCGAGTAACTTCACCCATTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2369s21c1
Sequence:CCGGGCAGGACATAAGGCAACGTTACTCGAGTAACGTTGCCTTATGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006310.3-3041s21c1
Sequence:CCGGTACCGAACAGCTGATTCATATCTCGAGATATGAATCAGCTGTTCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-3392s1c1
Sequence:CCGGCCAAGGATTGTAGTTTAGTTTCTCGAGAAACTAAACTACAATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1945s1c1
Sequence:CCGGGCTGGAATCATTAGCACTGTACTCGAGTACAGTGCTAATGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1786s1c1
Sequence:CCGGCCAGACCAATGGGTGAAGTTACTCGAGTAACTTCACCCATTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1792s1c1
Sequence:CCGGCAATGGGTGAAGTTAAACTTACTCGAGTAAGTTTAACTTCACCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-2209s1c1
Sequence:CCGGGCAGGACATAAGGCAACGTTACTCGAGTAACGTTGCCTTATGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006310
VALIDATED
NPEPPS MISSION shRNA Lentiviral Transduction Particles
aminopeptidase puromycin sensitive
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2105s21c1
Sequence:CCGGGCTGGAATCATTAGCACTGTACTCGAGTACAGTGCTAATGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2151s21c1
Sequence:CCGGTTGTGAATGAGCCCAATTATACTCGAGTATAATTGGGCTCATTCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-1946s21c1
Sequence:CCGGCCAGACCAATGGGTGAAGTTACTCGAGTAACTTCACCCATTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006310.3-2369s21c1
Sequence:CCGGGCAGGACATAAGGCAACGTTACTCGAGTAACGTTGCCTTATGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006310.3-3041s21c1
Sequence:CCGGTACCGAACAGCTGATTCATATCTCGAGATATGAATCAGCTGTTCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-3392s1c1
Sequence:CCGGCCAAGGATTGTAGTTTAGTTTCTCGAGAAACTAAACTACAATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1945s1c1
Sequence:CCGGGCTGGAATCATTAGCACTGTACTCGAGTACAGTGCTAATGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1786s1c1
Sequence:CCGGCCAGACCAATGGGTGAAGTTACTCGAGTAACTTCACCCATTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-1792s1c1
Sequence:CCGGCAATGGGTGAAGTTAAACTTACTCGAGTAAGTTTAACTTCACCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006310.2-2209s1c1
Sequence:CCGGGCAGGACATAAGGCAACGTTACTCGAGTAACGTTGCCTTATGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)