EMAIL THIS PAGE TO A FRIEND

NPFF

neuropeptide FF-amide peptide precursor

48 Gene Product Result for
Synonyms: FMRFAL
UniProtKB ID: O15130
Gene ID:
Human(8620) Summary: FMFRamide-related protein precursor plays a role in the regulation of heart rate and blood pressure and the modulation of morphine-induced antinociception. FMRFAL encodes a preproprotein which is cleaved to form two active peptides with similar function. [provided by RefSeq, Jul 2008]
Mouse(54615) neuropeptide FF-amide peptide precursor
Rat(60337) neuropeptide FF-amide peptide precursor
domestic cat(101088006) neuropeptide FF-amide peptide precursor
cow(281354) neuropeptide FF-amide peptide precursor
sheep(101102220) neuropeptide FF-amide peptide precursor
naked mole-rat(101700674) neuropeptide FF-amide peptide precursor
domestic guinea pig(100730764) neuropeptide FF-amide peptide precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301736 ANTI-NPFF (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003717 Rosetta Predictions human pricing
NM_022586 Rosetta Predictions rat pricing
NM_018787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162537 predicted 352
2 SASI_Hs01_00162538 predicted 349
3 SASI_Hs01_00162539 predicted 351
4 SASI_Hs01_00162540 predicted 339
5 SASI_Hs01_00162541 predicted 311
6 SASI_Hs01_00162542 predicted 280
7 SASI_Hs01_00162543 predicted 292
8 SASI_Hs02_00336144 predicted 298
9 SASI_Hs01_00162544 predicted 282
10 SASI_Hs01_00162545 predicted 510
11 SASI_Hs01_00162546 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094551 predicted 338
2 SASI_Rn01_00094552 predicted 369
3 SASI_Rn01_00094553 predicted 98
4 SASI_Rn01_00094554 predicted 333
5 SASI_Rn01_00094555 predicted 359
6 SASI_Rn02_00263329 predicted 247
7 SASI_Rn01_00094556 predicted 347
8 SASI_Rn01_00094558 predicted 348
9 SASI_Rn01_00094559 predicted 351
10 SASI_Rn01_00094560 predicted 220
11 SASI_Rn01_00094557 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200630 predicted 93
2 SASI_Mm01_00200631 predicted 360
3 SASI_Mm01_00200632 predicted 358
4 SASI_Mm01_00200633 predicted 331
5 SASI_Mm01_00200634 predicted 183
6 SASI_Mm01_00200635 predicted 98
7 SASI_Mm01_00200636 predicted 361
8 SASI_Mm01_00200637 predicted 94
9 SASI_Mm01_00200638 predicted 175
10 SASI_Mm01_00200639 predicted 96
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003717
NPFF MISSION shRNA Bacterial Glycerol Stock
neuropeptide FF-amide peptide precursor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-192s21c1
Sequence:CCGGCTGGTGCTGCTGCTGTTAATACTCGAGTATTAACAGCAGCAGCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-383s21c1
Sequence:CCGGCCAGAGGTTTGGCAGAAATACCTCGAGGTATTTCTGCCAAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-359s21c1
Sequence:CCGGGAGCCAAGCCTTCCTGTTTCACTCGAGTGAAACAGGAAGGCTTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-308s21c1
Sequence:CCGGCTCTGGGTCACTGTTGCACTACTCGAGTAGTGCAACAGTGACCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-407s21c1
Sequence:CCGGGGGATCCTGGAGGAATGAATGCTCGAGCATTCATTCCTCCAGGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003717
NPFF MISSION shRNA shRNA Plasmid DNA
neuropeptide FF-amide peptide precursor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-192s21c1
Sequence:CCGGCTGGTGCTGCTGCTGTTAATACTCGAGTATTAACAGCAGCAGCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-383s21c1
Sequence:CCGGCCAGAGGTTTGGCAGAAATACCTCGAGGTATTTCTGCCAAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-359s21c1
Sequence:CCGGGAGCCAAGCCTTCCTGTTTCACTCGAGTGAAACAGGAAGGCTTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-308s21c1
Sequence:CCGGCTCTGGGTCACTGTTGCACTACTCGAGTAGTGCAACAGTGACCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-407s21c1
Sequence:CCGGGGGATCCTGGAGGAATGAATGCTCGAGCATTCATTCCTCCAGGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003717
NPFF MISSION shRNA Lentiviral Transduction Particles
neuropeptide FF-amide peptide precursor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-192s21c1
Sequence:CCGGCTGGTGCTGCTGCTGTTAATACTCGAGTATTAACAGCAGCAGCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-383s21c1
Sequence:CCGGCCAGAGGTTTGGCAGAAATACCTCGAGGTATTTCTGCCAAACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-359s21c1
Sequence:CCGGGAGCCAAGCCTTCCTGTTTCACTCGAGTGAAACAGGAAGGCTTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-308s21c1
Sequence:CCGGCTCTGGGTCACTGTTGCACTACTCGAGTAGTGCAACAGTGACCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003717.2-407s21c1
Sequence:CCGGGGGATCCTGGAGGAATGAATGCTCGAGCATTCATTCCTCCAGGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018787
NPFF MISSION shRNA Bacterial Glycerol Stock
neuropeptide FF-amide peptide precursor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-137s1c1
Sequence:CCGGCCACCACAGTATGCCCACATTCTCGAGAATGTGGGCATACTGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-293s1c1
Sequence:CCGGCAGCTAAATCCGCAGGCCAGACTCGAGTCTGGCCTGCGGATTTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-103s1c1
Sequence:CCGGCCAAGTCTTTGCAGGAGAAGACTCGAGTCTTCTCCTGCAAAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-158s1c1
Sequence:CCGGCCAGACAGGATCCAGACTCCTCTCGAGAGGAGTCTGGATCCTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-207s1c1
Sequence:CCGGCCATGGACACACCTAGAAGGACTCGAGTCCTTCTAGGTGTGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018787
NPFF MISSION shRNA shRNA Plasmid DNA
neuropeptide FF-amide peptide precursor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-137s1c1
Sequence:CCGGCCACCACAGTATGCCCACATTCTCGAGAATGTGGGCATACTGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-293s1c1
Sequence:CCGGCAGCTAAATCCGCAGGCCAGACTCGAGTCTGGCCTGCGGATTTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-103s1c1
Sequence:CCGGCCAAGTCTTTGCAGGAGAAGACTCGAGTCTTCTCCTGCAAAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-158s1c1
Sequence:CCGGCCAGACAGGATCCAGACTCCTCTCGAGAGGAGTCTGGATCCTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-207s1c1
Sequence:CCGGCCATGGACACACCTAGAAGGACTCGAGTCCTTCTAGGTGTGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018787
NPFF MISSION shRNA Lentiviral Transduction Particles
neuropeptide FF-amide peptide precursor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-137s1c1
Sequence:CCGGCCACCACAGTATGCCCACATTCTCGAGAATGTGGGCATACTGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-293s1c1
Sequence:CCGGCAGCTAAATCCGCAGGCCAGACTCGAGTCTGGCCTGCGGATTTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-103s1c1
Sequence:CCGGCCAAGTCTTTGCAGGAGAAGACTCGAGTCTTCTCCTGCAAAGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-158s1c1
Sequence:CCGGCCAGACAGGATCCAGACTCCTCTCGAGAGGAGTCTGGATCCTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018787.1-207s1c1
Sequence:CCGGCCATGGACACACCTAGAAGGACTCGAGTCCTTCTAGGTGTGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)