EMAIL THIS PAGE TO A FRIEND

NPHP1

nephronophthisis 1 (juvenile)

93 Gene Product Result for
Synonyms: JBTS4 NPH1 SLSN1
UniProtKB ID: O15259, O14837
Gene ID:
Human(4867) Summary: This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(53885) nephronophthisis 1 (juvenile) homolog (human)
Rat(296136) nephronophthisis 1 (juvenile)
Zebrafish(100002391) nephronophthisis 1
chicken(421223) nephronophthisis 1 (juvenile)
dog(403780) nephronophthisis 1 (juvenile)
Horse(100051808) nephronophthisis 1 (juvenile)
cow(505421) nephronophthisis 1 (juvenile)
domestic cat(101085284) nephronophthisis 1 (juvenile)
domestic guinea pig(100725987) nephronophthisis 1 (juvenile) homolog (human)
naked mole-rat(101725630) nephronophthisis 1 (juvenile)
sheep(101116556) nephronophthisis 1 (juvenile)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000272 Rosetta Predictions human pricing
NM_001128178 Rosetta Predictions human pricing
NM_001128179 Rosetta Predictions human pricing
NM_207181 Rosetta Predictions human pricing
NM_001106506 Rosetta Predictions rat pricing
NM_016902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192384 predicted 1261
2 SASI_Hs01_00192385 predicted 1772
3 SASI_Hs01_00192386 predicted 952
4 SASI_Hs01_00192388 predicted 1074
5 SASI_Hs01_00192389 predicted 1702
6 SASI_Hs01_00192390 predicted 1607
7 SASI_Hs01_00192391 predicted 855
8 SASI_Hs01_00192392 predicted 1436
9 SASI_Hs01_00192393 predicted 1298
10 SASI_Hs02_00302228 predicted 1736
11 SASI_Hs01_00192387 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330756 predicted 1134
2 SASI_Hs02_00330757 predicted 1652
3 SASI_Hs02_00330758 predicted 953
4 SASI_Hs02_00330759 predicted 1575
5 SASI_Hs02_00330760 predicted 1481
6 SASI_Hs02_00330761 predicted 1310
7 SASI_Hs02_00330762 predicted 1171
8 SASI_Hs02_00330763 predicted 1614
9 SASI_Hs02_00330764 predicted 1058
10 SASI_Hs02_00330765 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330766 predicted 949
2 SASI_Hs02_00330767 predicted 1467
3 SASI_Hs02_00330768 predicted 1689
4 SASI_Hs02_00330769 predicted 760
5 SASI_Hs02_00330770 predicted 1390
6 SASI_Hs02_00330771 predicted 1295
7 SASI_Hs02_00330772 predicted 1120
8 SASI_Hs02_00330773 predicted 982
9 SASI_Hs02_00330774 predicted 1424
10 SASI_Hs02_00330775 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373803 predicted 1820
2 SASI_Hs02_00373804 predicted 700
3 SASI_Hs02_00373805 predicted 1118
4 SASI_Hs02_00373806 predicted 1739
5 SASI_Hs02_00373807 predicted 1647
6 SASI_Hs02_00373808 predicted 905
7 SASI_Hs02_00373809 predicted 2230
8 SASI_Hs02_00373810 predicted 1778
9 SASI_Hs02_00373811 predicted 2267
10 SASI_Hs02_00373812 predicted 1455
11 SASI_Hs01_00199046 predicted 552
12 SASI_Hs01_00199047 predicted 527
13 SASI_Hs01_00199048 predicted 717
14 SASI_Hs01_00199049 predicted 631
15 SASI_Hs01_00199050 predicted 132
16 SASI_Hs01_00199051 predicted 272
17 SASI_Hs01_00199052 predicted 449
18 SASI_Hs01_00199053 predicted 464
19 SASI_Hs01_00199054 predicted 123
20 SASI_Hs01_00199055 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219638 predicted 2281
2 SASI_Rn02_00219639 predicted 2875
3 SASI_Rn02_00219640 predicted 1662
4 SASI_Rn02_00219641 predicted 2887
5 SASI_Rn02_00219642 predicted 2907
6 SASI_Rn02_00219643 predicted 2143
7 SASI_Rn02_00219644 predicted 2259
8 SASI_Rn02_00219645 predicted 2793
9 SASI_Rn02_00219646 predicted 2543
10 SASI_Rn02_00219647 predicted 2674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323752 predicted 1921
2 SASI_Mm01_00088843 predicted 310
3 SASI_Mm01_00088844 predicted 1064
4 SASI_Mm02_00323753 predicted 1795
5 SASI_Mm02_00323754 predicted 1282
6 SASI_Mm01_00088846 predicted 1671
7 SASI_Mm01_00088847 predicted 966
8 SASI_Mm01_00088849 predicted 1122
9 SASI_Mm01_00088851 predicted 1389
10 SASI_Mm01_00088852 predicted 1305
11 SASI_Mm01_00088845 predicted 325
12 SASI_Mm01_00088848 predicted 1218
13 SASI_Mm01_00088850 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000272
VALIDATED
NPHP1 MISSION shRNA Bacterial Glycerol Stock
nephronophthisis 1 (juvenile)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000272.2-3073s1c1
Sequence:CCGGCCGAAGAAACAGGCCAGATAACTCGAGTTATCTGGCCTGTTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000272.2-1276s1c1
Sequence:CCGGCCTCTGTCTATTTGATGGTAACTCGAGTTACCATCAAATAGACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000272.2-1184s1c1
Sequence:CCGGCCAAGTCGTATTTCATTGATTCTCGAGAATCAATGAAATACGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000272.2-1518s1c1
Sequence:CCGGGCTGGGTGTTTCTTAAACTTTCTCGAGAAAGTTTAAGAAACACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000272.2-822s1c1
Sequence:CCGGCGGGCATCTTCTGTCTTGTTACTCGAGTAACAAGACAGAAGATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1416s21c1
Sequence:CCGGCCCAGGTTACTCGCATCTTACCTCGAGGTAAGATGCGAGTAACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1056s21c1
Sequence:CCCGTAACTACGATGGGAGCTATTCCTCGAGGAATAGCTCCCATCGTAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-909s21c1
Sequence:CCGGTAATAGTTCTGATGCGAAATACTCGAGTATTTCGCATCAGAACTATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-705s21c1
Sequence:CCGGGAACCTACCTAGAGCCTTATACTCGAGTATAAGGCTCTAGGTAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-840s21c1
Sequence:CCGGGTGCTGTTCAGAAAGCGATTTCTCGAGAAATCGCTTTCTGAACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1454s21c1
Sequence:CCGGGATTGCTTTATCAGGTCTAATCTCGAGATTAGACCTGATAAAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1121s21c1
Sequence:CCGGGGGAATCAATTTCGAGCAAATCTCGAGATTTGCTCGAAATTGATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000272.3-2651s21c1
Sequence:CCGGCATATTTGCAAATCATCTAACCTCGAGGTTAGATGATTTGCAAATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000272.3-2342s21c1
Sequence:CCGGCCTCCACGATTACGTGAATAACTCGAGTTATTCACGTAATCGTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000272
VALIDATED
NPHP1 MISSION shRNA shRNA Plasmid DNA
nephronophthisis 1 (juvenile)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000272.2-3073s1c1
Sequence:CCGGCCGAAGAAACAGGCCAGATAACTCGAGTTATCTGGCCTGTTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000272.2-1276s1c1
Sequence:CCGGCCTCTGTCTATTTGATGGTAACTCGAGTTACCATCAAATAGACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000272.2-1184s1c1
Sequence:CCGGCCAAGTCGTATTTCATTGATTCTCGAGAATCAATGAAATACGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000272.2-1518s1c1
Sequence:CCGGGCTGGGTGTTTCTTAAACTTTCTCGAGAAAGTTTAAGAAACACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000272.2-822s1c1
Sequence:CCGGCGGGCATCTTCTGTCTTGTTACTCGAGTAACAAGACAGAAGATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1416s21c1
Sequence:CCGGCCCAGGTTACTCGCATCTTACCTCGAGGTAAGATGCGAGTAACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1056s21c1
Sequence:CCCGTAACTACGATGGGAGCTATTCCTCGAGGAATAGCTCCCATCGTAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-909s21c1
Sequence:CCGGTAATAGTTCTGATGCGAAATACTCGAGTATTTCGCATCAGAACTATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-705s21c1
Sequence:CCGGGAACCTACCTAGAGCCTTATACTCGAGTATAAGGCTCTAGGTAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-840s21c1
Sequence:CCGGGTGCTGTTCAGAAAGCGATTTCTCGAGAAATCGCTTTCTGAACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1454s21c1
Sequence:CCGGGATTGCTTTATCAGGTCTAATCTCGAGATTAGACCTGATAAAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1121s21c1
Sequence:CCGGGGGAATCAATTTCGAGCAAATCTCGAGATTTGCTCGAAATTGATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000272.3-2651s21c1
Sequence:CCGGCATATTTGCAAATCATCTAACCTCGAGGTTAGATGATTTGCAAATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000272.3-2342s21c1
Sequence:CCGGCCTCCACGATTACGTGAATAACTCGAGTTATTCACGTAATCGTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000272
VALIDATED
NPHP1 MISSION shRNA Lentiviral Transduction Particles
nephronophthisis 1 (juvenile)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000272.2-3073s1c1
Sequence:CCGGCCGAAGAAACAGGCCAGATAACTCGAGTTATCTGGCCTGTTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000272.2-1276s1c1
Sequence:CCGGCCTCTGTCTATTTGATGGTAACTCGAGTTACCATCAAATAGACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000272.2-1184s1c1
Sequence:CCGGCCAAGTCGTATTTCATTGATTCTCGAGAATCAATGAAATACGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000272.2-1518s1c1
Sequence:CCGGGCTGGGTGTTTCTTAAACTTTCTCGAGAAAGTTTAAGAAACACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000272.2-822s1c1
Sequence:CCGGCGGGCATCTTCTGTCTTGTTACTCGAGTAACAAGACAGAAGATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1416s21c1
Sequence:CCGGCCCAGGTTACTCGCATCTTACCTCGAGGTAAGATGCGAGTAACCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1056s21c1
Sequence:CCCGTAACTACGATGGGAGCTATTCCTCGAGGAATAGCTCCCATCGTAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-909s21c1
Sequence:CCGGTAATAGTTCTGATGCGAAATACTCGAGTATTTCGCATCAGAACTATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-705s21c1
Sequence:CCGGGAACCTACCTAGAGCCTTATACTCGAGTATAAGGCTCTAGGTAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-840s21c1
Sequence:CCGGGTGCTGTTCAGAAAGCGATTTCTCGAGAAATCGCTTTCTGAACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1454s21c1
Sequence:CCGGGATTGCTTTATCAGGTCTAATCTCGAGATTAGACCTGATAAAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000272.3-1121s21c1
Sequence:CCGGGGGAATCAATTTCGAGCAAATCTCGAGATTTGCTCGAAATTGATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000272.3-2651s21c1
Sequence:CCGGCATATTTGCAAATCATCTAACCTCGAGGTTAGATGATTTGCAAATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000272.3-2342s21c1
Sequence:CCGGCCTCCACGATTACGTGAATAACTCGAGTTATTCACGTAATCGTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016902
VALIDATED
NPHP1 MISSION shRNA Bacterial Glycerol Stock
nephronophthisis 1 (juvenile)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016902.1-2118s1c1
Sequence:CCGGCAGGAAGACTTGCCTCAAACACTCGAGTGTTTGAGGCAAGTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-70s1c1
Sequence:CCGGGTTGATAGTTTGGTGACTGAACTCGAGTTCAGTCACCAAACTATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-447s1c1
Sequence:CCGGCCCGAAACAAGCAGAAACAGACTCGAGTCTGTTTCTGCTTGTTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-1671s1c1
Sequence:CCGGCCTGCAAAGTGCCGATTTAATCTCGAGATTAAATCGGCACTTTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-1671s21c1
Sequence:CCGGCCTGCAAAGTGCCGATTTAATCTCGAGATTAAATCGGCACTTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-70s21c1
Sequence:CCGGGTTGATAGTTTGGTGACTGAACTCGAGTTCAGTCACCAAACTATCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016902.3-2118s21c1
Sequence:CCGGCAGGAAGACTTGCCTCAAACACTCGAGTGTTTGAGGCAAGTCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-447s21c1
Sequence:CCGGCCCGAAACAAGCAGAAACAGACTCGAGTCTGTTTCTGCTTGTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016902
VALIDATED
NPHP1 MISSION shRNA shRNA Plasmid DNA
nephronophthisis 1 (juvenile)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016902.1-2118s1c1
Sequence:CCGGCAGGAAGACTTGCCTCAAACACTCGAGTGTTTGAGGCAAGTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-70s1c1
Sequence:CCGGGTTGATAGTTTGGTGACTGAACTCGAGTTCAGTCACCAAACTATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-447s1c1
Sequence:CCGGCCCGAAACAAGCAGAAACAGACTCGAGTCTGTTTCTGCTTGTTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-1671s1c1
Sequence:CCGGCCTGCAAAGTGCCGATTTAATCTCGAGATTAAATCGGCACTTTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-1671s21c1
Sequence:CCGGCCTGCAAAGTGCCGATTTAATCTCGAGATTAAATCGGCACTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-70s21c1
Sequence:CCGGGTTGATAGTTTGGTGACTGAACTCGAGTTCAGTCACCAAACTATCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016902.3-2118s21c1
Sequence:CCGGCAGGAAGACTTGCCTCAAACACTCGAGTGTTTGAGGCAAGTCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-447s21c1
Sequence:CCGGCCCGAAACAAGCAGAAACAGACTCGAGTCTGTTTCTGCTTGTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016902
VALIDATED
NPHP1 MISSION shRNA Lentiviral Transduction Particles
nephronophthisis 1 (juvenile)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016902.1-2118s1c1
Sequence:CCGGCAGGAAGACTTGCCTCAAACACTCGAGTGTTTGAGGCAAGTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-70s1c1
Sequence:CCGGGTTGATAGTTTGGTGACTGAACTCGAGTTCAGTCACCAAACTATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-447s1c1
Sequence:CCGGCCCGAAACAAGCAGAAACAGACTCGAGTCTGTTTCTGCTTGTTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016902.1-1671s1c1
Sequence:CCGGCCTGCAAAGTGCCGATTTAATCTCGAGATTAAATCGGCACTTTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-1671s21c1
Sequence:CCGGCCTGCAAAGTGCCGATTTAATCTCGAGATTAAATCGGCACTTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-70s21c1
Sequence:CCGGGTTGATAGTTTGGTGACTGAACTCGAGTTCAGTCACCAAACTATCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016902.3-2118s21c1
Sequence:CCGGCAGGAAGACTTGCCTCAAACACTCGAGTGTTTGAGGCAAGTCTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016902.3-447s21c1
Sequence:CCGGCCCGAAACAAGCAGAAACAGACTCGAGTCTGTTTCTGCTTGTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)