EMAIL THIS PAGE TO A FRIEND

NPHP3

nephronophthisis 3 (adolescent)

80 Gene Product Result for
Synonyms: MKS7 NPH3 RHPD
Gene ID:
Human(27031) Summary: This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
Mouse(74025) nephronophthisis 3 (adolescent)
Rat(363126) nephronophthisis 3 (adolescent)
sheep(101118406) nephronophthisis 3 (adolescent)
naked mole-rat(101713364) nephronophthisis 3 (adolescent)
domestic guinea pig(100720089) nephronophthisis 3 (adolescent)
Zebrafish(562601) nephronophthisis 3
chicken(420690) nephronophthisis 3 (adolescent)
dog(485665) nephronophthisis 3 (adolescent)
cow(507522) nephronophthisis 3 (adolescent)
Horse(100064940) nephronophthisis 3 (adolescent)
domestic cat(101090135) nephronophthisis 3 (adolescent)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153240 Rosetta Predictions human pricing
XM_343461 Rosetta Predictions rat pricing
XR_008810 Rosetta Predictions rat pricing
NM_028721 Rosetta Predictions mouse pricing
NM_172460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367104 predicted 1280
2 SASI_Hs01_00137052 predicted 3617
3 SASI_Hs01_00137053 predicted 3725
4 SASI_Hs01_00137054 predicted 1242
5 SASI_Hs02_00367105 predicted 3670
6 SASI_Hs02_00367106 predicted 2291
7 SASI_Hs01_00137057 predicted 1908
8 SASI_Hs02_00367107 predicted 2445
9 SASI_Hs02_00367108 predicted 1299
10 SASI_Hs01_00137059 predicted 1694
11 SASI_Hs01_00137051 predicted 3313
12 SASI_Hs01_00137055 predicted 1310
13 SASI_Hs01_00137056 predicted 1345
14 SASI_Hs01_00137058 predicted 4072
15 SASI_Hs01_00137060 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395804 predicted 241
2 SASI_Rn02_00395805 predicted 260
3 SASI_Rn02_00395806 predicted 217
4 SASI_Rn02_00395807 predicted 259
5 SASI_Rn02_00395808 predicted 263
6 SASI_Rn02_00395809 predicted 252
7 SASI_Rn02_00395810 predicted 242
8 SASI_Rn02_00395811 predicted 2419
9 SASI_Rn02_00395812 predicted 2788
10 SASI_Rn02_00395813 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143237 predicted 2376
2 SASI_Rn02_00417979 predicted 2744
3 SASI_Rn02_00417980 predicted 1664
4 SASI_Rn01_00143238 predicted 930
5 SASI_Rn01_00143240 predicted 2306
6 SASI_Rn01_00143241 predicted 4153
7 SASI_Rn01_00143242 predicted 1509
8 SASI_Rn01_00143243 predicted 1683
9 SASI_Rn01_00143244 predicted 1438
10 SASI_Rn01_00143246 predicted 1386
11 SASI_Rn01_00143239 predicted 3090
12 SASI_Rn01_00143245 predicted 2767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334277 predicted 635
2 SASI_Mm01_00187877 predicted 1217
3 SASI_Mm02_00334278 predicted 1258
4 SASI_Mm02_00334279 predicted 312
5 SASI_Mm02_00334280 predicted 1129
6 SASI_Mm01_00187884 predicted 1171
7 SASI_Mm02_00334281 predicted 516
8 SASI_Mm02_00334282 predicted 449
9 SASI_Mm02_00334283 predicted 1159
10 SASI_Mm02_00334284 predicted 766
11 SASI_Mm01_00187876 predicted 3971
12 SASI_Mm01_00187878 predicted 1337
13 SASI_Mm01_00187879 predicted 1430
14 SASI_Mm01_00187880 predicted 1875
15 SASI_Mm01_00187881 predicted 2032
16 SASI_Mm01_00187882 predicted 1673
17 SASI_Mm01_00187883 predicted 2879
18 SASI_Mm01_00187885 predicted 2556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343985 predicted 635
2 SASI_Mm02_00343986 predicted 1213
3 SASI_Mm02_00343987 predicted 1260
4 SASI_Mm02_00343988 predicted 310
5 SASI_Mm02_00343989 predicted 1132
6 SASI_Mm02_00343990 predicted 1175
7 SASI_Mm02_00343991 predicted 519
8 SASI_Mm02_00343992 predicted 457
9 SASI_Mm02_00343993 predicted 1150
10 SASI_Mm02_00343994 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153240
NPHP3 MISSION shRNA Bacterial Glycerol Stock
nephronophthisis 3 (adolescent)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-3684s1c1
Sequence:CCGGGCTGTTGAAATTCGACAGAAACTCGAGTTTCTGTCGAATTTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153240.3-4177s1c1
Sequence:CCGGCGTGTGATTTAACTGCTATTTCTCGAGAAATAGCAGTTAAATCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-2476s1c1
Sequence:CCGGCCTCCCTTATTCACAGTTTATCTCGAGATAAACTGTGAATAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-3738s1c1
Sequence:CCGGGCCTTGGTGAACTTAGCTGTTCTCGAGAACAGCTAAGTTCACCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-2899s1c1
Sequence:CCGGGCTTAGCTGATCTTTATGAAACTCGAGTTTCATAAAGATCAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153240
NPHP3 MISSION shRNA shRNA Plasmid DNA
nephronophthisis 3 (adolescent)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-3684s1c1
Sequence:CCGGGCTGTTGAAATTCGACAGAAACTCGAGTTTCTGTCGAATTTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153240.3-4177s1c1
Sequence:CCGGCGTGTGATTTAACTGCTATTTCTCGAGAAATAGCAGTTAAATCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-2476s1c1
Sequence:CCGGCCTCCCTTATTCACAGTTTATCTCGAGATAAACTGTGAATAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-3738s1c1
Sequence:CCGGGCCTTGGTGAACTTAGCTGTTCTCGAGAACAGCTAAGTTCACCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-2899s1c1
Sequence:CCGGGCTTAGCTGATCTTTATGAAACTCGAGTTTCATAAAGATCAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153240
NPHP3 MISSION shRNA Lentiviral Transduction Particles
nephronophthisis 3 (adolescent)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-3684s1c1
Sequence:CCGGGCTGTTGAAATTCGACAGAAACTCGAGTTTCTGTCGAATTTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153240.3-4177s1c1
Sequence:CCGGCGTGTGATTTAACTGCTATTTCTCGAGAAATAGCAGTTAAATCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-2476s1c1
Sequence:CCGGCCTCCCTTATTCACAGTTTATCTCGAGATAAACTGTGAATAAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-3738s1c1
Sequence:CCGGGCCTTGGTGAACTTAGCTGTTCTCGAGAACAGCTAAGTTCACCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153240.3-2899s1c1
Sequence:CCGGGCTTAGCTGATCTTTATGAAACTCGAGTTTCATAAAGATCAGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028721
VALIDATED
NPHP3 MISSION shRNA Bacterial Glycerol Stock
nephronophthisis 3 (adolescent)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-3877s1c1
Sequence:CCGGCCACTATATGAAAGAGCATTACTCGAGTAATGCTCTTTCATATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-3040s21c1
Sequence:CCGGCTGTGCCTAGCCGACCTATATCTCGAGATATAGGTCGGCTAGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-2092s1c1
Sequence:CCGGCCGGTGAATGTCAGAGTCATTCTCGAGAATGACTCTGACATTCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028721.2-4166s1c1
Sequence:CCGGGCAAGGATACTTCAAGATAAACTCGAGTTTATCTTGAAGTATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-3766s1c1
Sequence:CCGGGCTGTTGAAATTCGGCAGAAACTCGAGTTTCTGCCGAATTTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028721.2-999s1c1
Sequence:CCGGCGCTGCTGTAGCTGGTTTATTCTCGAGAATAAACCAGCTACAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-2249s21c1
Sequence:CCGGAGGACGCCATATCTATAATAACTCGAGTTATTATAGATATGGCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-1475s21c1
Sequence:CCGGACCTAGGCAAGACCACTAAAGCTCGAGCTTTAGTGGTCTTGCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-4204s21c1
Sequence:CCGGGGGCAAAGCTAACCGTCAATTCTCGAGAATTGACGGTTAGCTTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028721.3-4603s21c1
Sequence:CCGGGCTAAAGGGATGTTGATAATACTCGAGTATTATCAACATCCCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-2501s21c1
Sequence:CCGGTGCCAAGTGACAGGGATAAAGCTCGAGCTTTATCCCTGTCACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-1209s21c1
Sequence:CCGGGTGCGAGACAATGGGATATTTCTCGAGAAATATCCCATTGTCTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-3929s21c1
Sequence:CCGGGTGAAGCCCTGCCACTATATGCTCGAGCATATAGTGGCAGGGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028721
VALIDATED
NPHP3 MISSION shRNA shRNA Plasmid DNA
nephronophthisis 3 (adolescent)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-3877s1c1
Sequence:CCGGCCACTATATGAAAGAGCATTACTCGAGTAATGCTCTTTCATATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-3040s21c1
Sequence:CCGGCTGTGCCTAGCCGACCTATATCTCGAGATATAGGTCGGCTAGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-2092s1c1
Sequence:CCGGCCGGTGAATGTCAGAGTCATTCTCGAGAATGACTCTGACATTCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028721.2-4166s1c1
Sequence:CCGGGCAAGGATACTTCAAGATAAACTCGAGTTTATCTTGAAGTATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-3766s1c1
Sequence:CCGGGCTGTTGAAATTCGGCAGAAACTCGAGTTTCTGCCGAATTTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028721.2-999s1c1
Sequence:CCGGCGCTGCTGTAGCTGGTTTATTCTCGAGAATAAACCAGCTACAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-2249s21c1
Sequence:CCGGAGGACGCCATATCTATAATAACTCGAGTTATTATAGATATGGCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-1475s21c1
Sequence:CCGGACCTAGGCAAGACCACTAAAGCTCGAGCTTTAGTGGTCTTGCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-4204s21c1
Sequence:CCGGGGGCAAAGCTAACCGTCAATTCTCGAGAATTGACGGTTAGCTTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028721.3-4603s21c1
Sequence:CCGGGCTAAAGGGATGTTGATAATACTCGAGTATTATCAACATCCCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-2501s21c1
Sequence:CCGGTGCCAAGTGACAGGGATAAAGCTCGAGCTTTATCCCTGTCACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-1209s21c1
Sequence:CCGGGTGCGAGACAATGGGATATTTCTCGAGAAATATCCCATTGTCTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-3929s21c1
Sequence:CCGGGTGAAGCCCTGCCACTATATGCTCGAGCATATAGTGGCAGGGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028721
VALIDATED
NPHP3 MISSION shRNA Lentiviral Transduction Particles
nephronophthisis 3 (adolescent)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-3877s1c1
Sequence:CCGGCCACTATATGAAAGAGCATTACTCGAGTAATGCTCTTTCATATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-3040s21c1
Sequence:CCGGCTGTGCCTAGCCGACCTATATCTCGAGATATAGGTCGGCTAGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-2092s1c1
Sequence:CCGGCCGGTGAATGTCAGAGTCATTCTCGAGAATGACTCTGACATTCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028721.2-4166s1c1
Sequence:CCGGGCAAGGATACTTCAAGATAAACTCGAGTTTATCTTGAAGTATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028721.2-3766s1c1
Sequence:CCGGGCTGTTGAAATTCGGCAGAAACTCGAGTTTCTGCCGAATTTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028721.2-999s1c1
Sequence:CCGGCGCTGCTGTAGCTGGTTTATTCTCGAGAATAAACCAGCTACAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-2249s21c1
Sequence:CCGGAGGACGCCATATCTATAATAACTCGAGTTATTATAGATATGGCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-1475s21c1
Sequence:CCGGACCTAGGCAAGACCACTAAAGCTCGAGCTTTAGTGGTCTTGCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-4204s21c1
Sequence:CCGGGGGCAAAGCTAACCGTCAATTCTCGAGAATTGACGGTTAGCTTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028721.3-4603s21c1
Sequence:CCGGGCTAAAGGGATGTTGATAATACTCGAGTATTATCAACATCCCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028721.3-2501s21c1
Sequence:CCGGTGCCAAGTGACAGGGATAAAGCTCGAGCTTTATCCCTGTCACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-1209s21c1
Sequence:CCGGGTGCGAGACAATGGGATATTTCTCGAGAAATATCCCATTGTCTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028721.3-3929s21c1
Sequence:CCGGGTGAAGCCCTGCCACTATATGCTCGAGCATATAGTGGCAGGGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)