EMAIL THIS PAGE TO A FRIEND

NPHS1

nephrosis 1, congenital, Finnish type (nephrin)

69 Gene Product Result for
Synonyms: CNF NPHN nephrin
UniProtKB ID: O60500, A6NDH2, C3RX61
Gene ID:
Human(4868) Summary: This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
Mouse(54631) nephrosis 1, nephrin
Rat(64563) nephrosis 1, congenital, Finnish type (nephrin)
sheep(101115895) nephrosis 1, congenital, Finnish type (nephrin)
naked mole-rat(101705086) nephrosis 1, congenital, Finnish type (nephrin)
Domestic Rabbit(100354996) nephrosis 1, congenital, Finnish type (nephrin)
domestic guinea pig(100713185) nephrosis 1, congenital, Finnish type (nephrin)
Zebrafish(692352) nephrosis 1, congenital, Finnish type (nephrin)
domestic cat(101101018) nephrosis 1, congenital, Finnish type (nephrin)
dog(484571) nephrosis 1, congenital, Finnish type (nephrin)
cow(519706) nephrosis 1, congenital, Finnish type (nephrin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306092 ANTI-NEPHRIN (Y1210) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
flow cytometry, western blot pricing
PRS2265 Anti-Nephrin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900278 Anti-NPHS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB3500770 Anti-NPHS1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry pricing
SAB1305596 ANTI-PHOSPHO-NEPHRIN(Y1193)) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305597 ANTI-PHOSPHO-NEPHRIN(Y1210)) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
PRS4623 Anti-SAPAP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1305544 MONOCLONAL ANTI-NEPHRIN antibody produced in mouse clone 174CT2.1.1, crude ascites, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1402860 Monoclonal Anti-NPHS1 antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004646 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004646 Rosetta Predictions human pricing
NM_022628 Rosetta Predictions rat pricing
NM_019459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034995 predicted 1022
2 SASI_Hs01_00034996 predicted 3519
3 SASI_Hs02_00338056 predicted 510
4 SASI_Hs01_00034997 predicted 1723
5 SASI_Hs01_00034998 predicted 3457
6 SASI_Hs01_00034999 predicted 1243
7 SASI_Hs02_00338057 predicted 1905
8 SASI_Hs01_00035000 predicted 526
9 SASI_Hs01_00035001 predicted 1678
10 SASI_Hs01_00035004 predicted 684
11 SASI_Hs01_00035002 predicted 1187
12 SASI_Hs01_00035003 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098275 predicted 2807
2 SASI_Rn01_00098276 predicted 1431
3 SASI_Rn01_00098277 predicted 3451
4 SASI_Rn01_00098278 predicted 2159
5 SASI_Rn02_00263415 predicted 2165
6 SASI_Rn01_00098279 predicted 704
7 SASI_Rn01_00098280 predicted 2790
8 SASI_Rn01_00098281 predicted 1130
9 SASI_Rn02_00263416 predicted 2327
10 SASI_Rn01_00098283 predicted 3839
11 SASI_Rn01_00098282 predicted 949
12 SASI_Rn01_00098284 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152484 predicted 1147
2 SASI_Mm01_00152485 predicted 1851
3 SASI_Mm01_00152487 predicted 2011
4 SASI_Mm01_00152488 predicted 386
5 SASI_Mm01_00152489 predicted 3140
6 SASI_Mm01_00152491 predicted 811
7 SASI_Mm01_00152493 predicted 3070
8 SASI_Mm02_00324453 predicted 3948
9 SASI_Mm02_00324454 predicted 320
10 SASI_Mm02_00324455 predicted 2887
11 SASI_Mm01_00152486 predicted 1724
12 SASI_Mm01_00152490 predicted 2832
13 SASI_Mm01_00152492 predicted 2310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019459
NPHS1 MISSION shRNA Bacterial Glycerol Stock
nephrosis 1, congenital, Finnish type (nephrin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-3454s1c1
Sequence:CCGGACACTGGAAGAGGTGTCATATCTCGAGATATGACACCTCTTCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-1719s1c1
Sequence:CCGGCCCTCCAGTTAACTTGTCTTTCTCGAGAAAGACAAGTTAACTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-1923s1c1
Sequence:CCGGCGTGTTATACCCTCCAGAGTTCTCGAGAACTCTGGAGGGTATAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-3478s1c1
Sequence:CCGGCAAGCCTTCACAGGTATTGAACTCGAGTTCAATACCTGTGAAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-675s1c1
Sequence:CCGGCACTCCCATAAAGGCTTCGTTCTCGAGAACGAAGCCTTTATGGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019459
NPHS1 MISSION shRNA shRNA Plasmid DNA
nephrosis 1, congenital, Finnish type (nephrin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-3454s1c1
Sequence:CCGGACACTGGAAGAGGTGTCATATCTCGAGATATGACACCTCTTCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-1719s1c1
Sequence:CCGGCCCTCCAGTTAACTTGTCTTTCTCGAGAAAGACAAGTTAACTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-1923s1c1
Sequence:CCGGCGTGTTATACCCTCCAGAGTTCTCGAGAACTCTGGAGGGTATAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-3478s1c1
Sequence:CCGGCAAGCCTTCACAGGTATTGAACTCGAGTTCAATACCTGTGAAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-675s1c1
Sequence:CCGGCACTCCCATAAAGGCTTCGTTCTCGAGAACGAAGCCTTTATGGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019459
NPHS1 MISSION shRNA Lentiviral Transduction Particles
nephrosis 1, congenital, Finnish type (nephrin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-3454s1c1
Sequence:CCGGACACTGGAAGAGGTGTCATATCTCGAGATATGACACCTCTTCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-1719s1c1
Sequence:CCGGCCCTCCAGTTAACTTGTCTTTCTCGAGAAAGACAAGTTAACTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-1923s1c1
Sequence:CCGGCGTGTTATACCCTCCAGAGTTCTCGAGAACTCTGGAGGGTATAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-3478s1c1
Sequence:CCGGCAAGCCTTCACAGGTATTGAACTCGAGTTCAATACCTGTGAAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019459.1-675s1c1
Sequence:CCGGCACTCCCATAAAGGCTTCGTTCTCGAGAACGAAGCCTTTATGGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004646
NPHS1 MISSION shRNA Bacterial Glycerol Stock
nephrosis 1, congenital, Finnish type (nephrin)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-3520s1c1
Sequence:CCGGCACTTGTATGATGAGGTAGAACTCGAGTTCTACCTCATCATACAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-1024s1c1
Sequence:CCGGGCCATTATTATCTTGGGATCTCTCGAGAGATCCCAAGATAATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-688s1c1
Sequence:CCGGGCCTCATTCACCGTGAATGTTCTCGAGAACATTCACGGTGAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-2487s1c1
Sequence:CCGGGCTCCGTCTTGTTGTCAGATTCTCGAGAATCTGACAACAAGACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004646.1-4013s1c1
Sequence:CCGGCGCCTATAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004646
NPHS1 MISSION shRNA shRNA Plasmid DNA
nephrosis 1, congenital, Finnish type (nephrin)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-3520s1c1
Sequence:CCGGCACTTGTATGATGAGGTAGAACTCGAGTTCTACCTCATCATACAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-1024s1c1
Sequence:CCGGGCCATTATTATCTTGGGATCTCTCGAGAGATCCCAAGATAATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-688s1c1
Sequence:CCGGGCCTCATTCACCGTGAATGTTCTCGAGAACATTCACGGTGAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-2487s1c1
Sequence:CCGGGCTCCGTCTTGTTGTCAGATTCTCGAGAATCTGACAACAAGACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004646.1-4013s1c1
Sequence:CCGGCGCCTATAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004646
NPHS1 MISSION shRNA Lentiviral Transduction Particles
nephrosis 1, congenital, Finnish type (nephrin)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-3520s1c1
Sequence:CCGGCACTTGTATGATGAGGTAGAACTCGAGTTCTACCTCATCATACAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-1024s1c1
Sequence:CCGGGCCATTATTATCTTGGGATCTCTCGAGAGATCCCAAGATAATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-688s1c1
Sequence:CCGGGCCTCATTCACCGTGAATGTTCTCGAGAACATTCACGGTGAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004646.1-2487s1c1
Sequence:CCGGGCTCCGTCTTGTTGTCAGATTCTCGAGAATCTGACAACAAGACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004646.1-4013s1c1
Sequence:CCGGCGCCTATAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)