EMAIL THIS PAGE TO A FRIEND

NPHS2

nephrosis 2, idiopathic, steroid-resistant (podocin)

47 Gene Product Result for
Synonyms: PDCN SRN1
UniProtKB ID: Q9NP85, B1AM32, B1AM33, Q8N6Q5
Gene ID:
Human(7827) Summary: This gene encodes the glomerular protein podocin which plays a role in the regulation of glomerular permeability, and acts as a linker between the plasma membrane and the cytoskeleton. Defects in this gene are the cause of autosomal recessive steroid-resistant nephrotic syndrome (SRN). SRN is characterized by onset between three months and five years, resistance to steroid therapy and rapid progression to end-stage renal disease. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(170484) nephrosis 2, podocin
Rat(170672) nephrosis 2, idiopathic, steroid-resistant
sheep(101121618) nephrosis 2, idiopathic, steroid-resistant (podocin)
domestic guinea pig(100716190) nephrosis 2, idiopathic, steroid-resistant (podocin)
naked mole-rat(101704471) nephrosis 2, idiopathic, steroid-resistant (podocin)
Zebrafish(557914) nephrosis 2, idiopathic, steroid-resistant (podocin)
cow(537633) nephrosis 2, idiopathic, steroid-resistant (podocin)
domestic cat(101084927) nephrosis 2, idiopathic, steroid-resistant (podocin)
dog(490323) nephrosis 2, idiopathic, steroid-resistant (podocin)
chicken(424422) nephrosis 2, idiopathic, steroid-resistant (podocin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085591 MISSION® esiRNA targeting human NPHS2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014625 Rosetta Predictions human pricing
NM_130828 Rosetta Predictions rat pricing
NM_130456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194364 predicted 1449
2 SASI_Hs01_00194365 predicted 1177
3 SASI_Hs02_00345921 predicted 1437
4 SASI_Hs01_00194366 predicted 1433
5 SASI_Hs02_00345922 predicted 1360
6 SASI_Hs01_00194367 predicted 1502
7 SASI_Hs02_00345923 predicted 1281
8 SASI_Hs01_00194371 predicted 1460
9 SASI_Hs02_00345924 predicted 1377
10 SASI_Hs01_00194372 predicted 1451
11 SASI_Hs01_00194363 predicted 1455
12 SASI_Hs01_00194368 predicted 1267
13 SASI_Hs01_00194369 predicted 1383
14 SASI_Hs01_00194370 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065162 predicted 595
2 SASI_Rn01_00065163 predicted 329
3 SASI_Rn01_00065164 predicted 1153
4 SASI_Rn01_00065165 predicted 432
5 SASI_Rn01_00065166 predicted 777
6 SASI_Rn01_00065167 predicted 593
7 SASI_Rn01_00065168 predicted 446
8 SASI_Rn01_00065170 predicted 1146
9 SASI_Rn01_00065171 predicted 1241
10 SASI_Rn02_00267524 predicted 424
11 SASI_Rn01_00065169 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135801 predicted 1154
2 SASI_Mm01_00135802 predicted 1081
3 SASI_Mm01_00135803 predicted 1401
4 SASI_Mm02_00338264 predicted 775
5 SASI_Mm01_00135805 predicted 1451
6 SASI_Mm02_00338265 predicted 1374
7 SASI_Mm01_00135806 predicted 1194
8 SASI_Mm01_00135807 predicted 841
9 SASI_Mm01_00135808 predicted 752
10 SASI_Mm01_00135809 predicted 733
11 SASI_Mm01_00135804 predicted 1496
12 SASI_Mm01_00135810 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014625
NPHS2 MISSION shRNA Bacterial Glycerol Stock
nephrosis 2, idiopathic, steroid-resistant (podocin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014625.2-1504s21c1
Sequence:CCGGTGAGTCTAGATGTGGTTAAATCTCGAGATTTAACCACATCTAGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014625.1-1667s1c1
Sequence:CCGGCCAATGATACTACCAAGTCTTCTCGAGAAGACTTGGTAGTATCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-928s1c1
Sequence:CCGGCAAGCCAAAGTGCGGATGATTCTCGAGAATCATCCGCACTTTGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-696s1c1
Sequence:CCGGTGTATCTAAAGCTGTGCAATTCTCGAGAATTGCACAGCTTTAGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-717s1c1
Sequence:CCGGCCTTGTGCAAACCACTATGAACTCGAGTTCATAGTGGTTTGCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-1170s1c1
Sequence:CCGGCAAACCTGTTGAGCCACTAAACTCGAGTTTAGTGGCTCAACAGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014625.2-621s21c1
Sequence:CCGGTCGTGACCAAAGACATGTTTACTCGAGTAAACATGTCTTTGGTCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014625.2-442s21c1
Sequence:CCGGTTCCATCTGGTTCTGCGTAAACTCGAGTTTACGCAGAACCAGATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014625
NPHS2 MISSION shRNA shRNA Plasmid DNA
nephrosis 2, idiopathic, steroid-resistant (podocin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014625.2-1504s21c1
Sequence:CCGGTGAGTCTAGATGTGGTTAAATCTCGAGATTTAACCACATCTAGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014625.1-1667s1c1
Sequence:CCGGCCAATGATACTACCAAGTCTTCTCGAGAAGACTTGGTAGTATCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-928s1c1
Sequence:CCGGCAAGCCAAAGTGCGGATGATTCTCGAGAATCATCCGCACTTTGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-696s1c1
Sequence:CCGGTGTATCTAAAGCTGTGCAATTCTCGAGAATTGCACAGCTTTAGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-717s1c1
Sequence:CCGGCCTTGTGCAAACCACTATGAACTCGAGTTCATAGTGGTTTGCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-1170s1c1
Sequence:CCGGCAAACCTGTTGAGCCACTAAACTCGAGTTTAGTGGCTCAACAGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014625.2-621s21c1
Sequence:CCGGTCGTGACCAAAGACATGTTTACTCGAGTAAACATGTCTTTGGTCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014625.2-442s21c1
Sequence:CCGGTTCCATCTGGTTCTGCGTAAACTCGAGTTTACGCAGAACCAGATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014625
NPHS2 MISSION shRNA Lentiviral Transduction Particles
nephrosis 2, idiopathic, steroid-resistant (podocin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014625.2-1504s21c1
Sequence:CCGGTGAGTCTAGATGTGGTTAAATCTCGAGATTTAACCACATCTAGACTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014625.1-1667s1c1
Sequence:CCGGCCAATGATACTACCAAGTCTTCTCGAGAAGACTTGGTAGTATCATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-928s1c1
Sequence:CCGGCAAGCCAAAGTGCGGATGATTCTCGAGAATCATCCGCACTTTGGCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-696s1c1
Sequence:CCGGTGTATCTAAAGCTGTGCAATTCTCGAGAATTGCACAGCTTTAGATACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-717s1c1
Sequence:CCGGCCTTGTGCAAACCACTATGAACTCGAGTTCATAGTGGTTTGCACAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014625.1-1170s1c1
Sequence:CCGGCAAACCTGTTGAGCCACTAAACTCGAGTTTAGTGGCTCAACAGGTTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014625.2-621s21c1
Sequence:CCGGTCGTGACCAAAGACATGTTTACTCGAGTAAACATGTCTTTGGTCACGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014625.2-442s21c1
Sequence:CCGGTTCCATCTGGTTCTGCGTAAACTCGAGTTTACGCAGAACCAGATGGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130456
NPHS2 MISSION shRNA Bacterial Glycerol Stock
nephrosis 2, idiopathic, steroid-resistant (podocin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1159s1c1
Sequence:CCGGCCAAACCAGTTGAACCACTAACTCGAGTTAGTGGTTCAACTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1081s1c1
Sequence:CCGGCTTTGCCATTTGACATGCTAACTCGAGTTAGCATGTCAAATGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1020s1c1
Sequence:CCGGCTTCGATACTTGCACACTCTTCTCGAGAAGAGTGTGCAAGTATCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-786s1c1
Sequence:CCGGCAAGATGTAAAGGTTGCCTTACTCGAGTAAGGCAACCTTTACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130456.2-1293s1c1
Sequence:CCGGCGCACTTGTTTGGTTGCCAAACTCGAGTTTGGCAACCAAACAAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130456
NPHS2 MISSION shRNA shRNA Plasmid DNA
nephrosis 2, idiopathic, steroid-resistant (podocin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1159s1c1
Sequence:CCGGCCAAACCAGTTGAACCACTAACTCGAGTTAGTGGTTCAACTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1081s1c1
Sequence:CCGGCTTTGCCATTTGACATGCTAACTCGAGTTAGCATGTCAAATGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1020s1c1
Sequence:CCGGCTTCGATACTTGCACACTCTTCTCGAGAAGAGTGTGCAAGTATCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-786s1c1
Sequence:CCGGCAAGATGTAAAGGTTGCCTTACTCGAGTAAGGCAACCTTTACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130456.2-1293s1c1
Sequence:CCGGCGCACTTGTTTGGTTGCCAAACTCGAGTTTGGCAACCAAACAAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130456
NPHS2 MISSION shRNA Lentiviral Transduction Particles
nephrosis 2, idiopathic, steroid-resistant (podocin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1159s1c1
Sequence:CCGGCCAAACCAGTTGAACCACTAACTCGAGTTAGTGGTTCAACTGGTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1081s1c1
Sequence:CCGGCTTTGCCATTTGACATGCTAACTCGAGTTAGCATGTCAAATGGCAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-1020s1c1
Sequence:CCGGCTTCGATACTTGCACACTCTTCTCGAGAAGAGTGTGCAAGTATCGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130456.2-786s1c1
Sequence:CCGGCAAGATGTAAAGGTTGCCTTACTCGAGTAAGGCAACCTTTACATCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000112980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130456.2-1293s1c1
Sequence:CCGGCGCACTTGTTTGGTTGCCAAACTCGAGTTTGGCAACCAAACAAGTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???