EMAIL THIS PAGE TO A FRIEND

NPIPB15

nuclear pore complex interacting protein family, member B15

9 Gene Product Result for
Synonyms: A-761H5.4 NPIPL2
Species: Human NPIPB15(440348)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018059 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306949 predicted 777
2 SASI_Hs02_00306950 predicted 774
3 SASI_Hs02_00306951 predicted 709
4 SASI_Hs01_00209129 predicted 671
5 SASI_Hs01_00209130 predicted 955
6 SASI_Hs01_00209131 predicted 648
7 SASI_Hs01_00209132 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018059
NPIPB15 MISSION shRNA Bacterial Glycerol Stock
nuclear pore complex interacting protein family, member B15
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-69s1c1
Sequence:CCGGGTCTTTCCTGAAGACTATCTTCTCGAGAAGATAGTCTTCAGGAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-174s1c1
Sequence:CCGGGTCCATTTGTATGCACACAAACTCGAGTTTGTGTGCATACAAATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-403s1c1
Sequence:CCGGGAGGACTACCACAAATGCAAACTCGAGTTTGCATTTGTGGTAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-431s1c1
Sequence:CCGGCTTCTGCAAGAAAGCCTCTTTCTCGAGAAAGAGGCTTTCTTGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-833s1c1
Sequence:CCGGCCTCAGTGGATGATAATCTCACTCGAGTGAGATTATCATCCACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-64s1c1
Sequence:CCGGCCTGTGTCTTTCCTGAAGACTCTCGAGAGTCTTCAGGAAAGACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-640s1c1
Sequence:CCGGCCACCCTCAGTGGATGATAATCTCGAGATTATCATCCACTGAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-925s1c1
Sequence:CCGGGAGGTGGAACAATCACCGAAACTCGAGTTTCGGTGATTGTTCCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-241s1c1
Sequence:CCGGGTCATTACTCTACGGAGGCATCTCGAGATGCCTCCGTAGAGTAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-36s1c1
Sequence:CCGGGCTGGGATTTATCAGCCATCACTCGAGTGATGGCTGATAAATCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-793s1c1
Sequence:CCGGGAATGTCTCTTTGTCCCGCTTCTCGAGAAGCGGGACAAAGAGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-707s1c1
Sequence:CCGGCCTCAGTGGATGATAATCTGACTCGAGTCAGATTATCATCCACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018059
NPIPB15 MISSION shRNA shRNA Plasmid DNA
nuclear pore complex interacting protein family, member B15
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-69s1c1
Sequence:CCGGGTCTTTCCTGAAGACTATCTTCTCGAGAAGATAGTCTTCAGGAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-174s1c1
Sequence:CCGGGTCCATTTGTATGCACACAAACTCGAGTTTGTGTGCATACAAATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-403s1c1
Sequence:CCGGGAGGACTACCACAAATGCAAACTCGAGTTTGCATTTGTGGTAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-431s1c1
Sequence:CCGGCTTCTGCAAGAAAGCCTCTTTCTCGAGAAAGAGGCTTTCTTGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-833s1c1
Sequence:CCGGCCTCAGTGGATGATAATCTCACTCGAGTGAGATTATCATCCACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-64s1c1
Sequence:CCGGCCTGTGTCTTTCCTGAAGACTCTCGAGAGTCTTCAGGAAAGACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-640s1c1
Sequence:CCGGCCACCCTCAGTGGATGATAATCTCGAGATTATCATCCACTGAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-925s1c1
Sequence:CCGGGAGGTGGAACAATCACCGAAACTCGAGTTTCGGTGATTGTTCCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-241s1c1
Sequence:CCGGGTCATTACTCTACGGAGGCATCTCGAGATGCCTCCGTAGAGTAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-36s1c1
Sequence:CCGGGCTGGGATTTATCAGCCATCACTCGAGTGATGGCTGATAAATCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-793s1c1
Sequence:CCGGGAATGTCTCTTTGTCCCGCTTCTCGAGAAGCGGGACAAAGAGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-707s1c1
Sequence:CCGGCCTCAGTGGATGATAATCTGACTCGAGTCAGATTATCATCCACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018059
NPIPB15 MISSION shRNA Lentiviral Transduction Particles
nuclear pore complex interacting protein family, member B15
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-69s1c1
Sequence:CCGGGTCTTTCCTGAAGACTATCTTCTCGAGAAGATAGTCTTCAGGAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-174s1c1
Sequence:CCGGGTCCATTTGTATGCACACAAACTCGAGTTTGTGTGCATACAAATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-403s1c1
Sequence:CCGGGAGGACTACCACAAATGCAAACTCGAGTTTGCATTTGTGGTAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-431s1c1
Sequence:CCGGCTTCTGCAAGAAAGCCTCTTTCTCGAGAAAGAGGCTTTCTTGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-833s1c1
Sequence:CCGGCCTCAGTGGATGATAATCTCACTCGAGTGAGATTATCATCCACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-64s1c1
Sequence:CCGGCCTGTGTCTTTCCTGAAGACTCTCGAGAGTCTTCAGGAAAGACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-640s1c1
Sequence:CCGGCCACCCTCAGTGGATGATAATCTCGAGATTATCATCCACTGAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-925s1c1
Sequence:CCGGGAGGTGGAACAATCACCGAAACTCGAGTTTCGGTGATTGTTCCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-241s1c1
Sequence:CCGGGTCATTACTCTACGGAGGCATCTCGAGATGCCTCCGTAGAGTAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018059.1-36s1c1
Sequence:CCGGGCTGGGATTTATCAGCCATCACTCGAGTGATGGCTGATAAATCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-793s1c1
Sequence:CCGGGAATGTCTCTTTGTCCCGCTTCTCGAGAAGCGGGACAAAGAGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001018059.1-707s1c1
Sequence:CCGGCCTCAGTGGATGATAATCTGACTCGAGTCAGATTATCATCCACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)