EMAIL THIS PAGE TO A FRIEND

NPIPB3

nuclear pore complex interacting protein family, member B3

240 Gene Product Result for
Synonyms: KIAA0220L NPIPL3
Species: Human NPIPB3(23117)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130464 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106191 MISSION® esiRNA esiRNA human AC106788.3-203 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130464 Rosetta Predictions human pricing
XM_290670 Rosetta Predictions human pricing
XM_933713 Rosetta Predictions human pricing
XM_933714 Rosetta Predictions human pricing
XM_933734 Rosetta Predictions human pricing
XM_933812 Rosetta Predictions human pricing
XM_933815 Rosetta Predictions human pricing
XM_933818 Rosetta Predictions human pricing
XM_933819 Rosetta Predictions human pricing
XM_933822 Rosetta Predictions human pricing
XM_933823 Rosetta Predictions human pricing
XM_933824 Rosetta Predictions human pricing
XM_933826 Rosetta Predictions human pricing
XM_933829 Rosetta Predictions human pricing
XM_933831 Rosetta Predictions human pricing
XM_933834 Rosetta Predictions human pricing
XM_933837 Rosetta Predictions human pricing
XM_933840 Rosetta Predictions human pricing
XM_933844 Rosetta Predictions human pricing
XM_933847 Rosetta Predictions human pricing
XM_933850 Rosetta Predictions human pricing
XM_933855 Rosetta Predictions human pricing
XM_933860 Rosetta Predictions human pricing
XM_933864 Rosetta Predictions human pricing
XM_933867 Rosetta Predictions human pricing
XM_933869 Rosetta Predictions human pricing
XM_933873 Rosetta Predictions human pricing
XM_933880 Rosetta Predictions human pricing
XM_933881 Rosetta Predictions human pricing
XM_933883 Rosetta Predictions human pricing
XM_933885 Rosetta Predictions human pricing
XM_933891 Rosetta Predictions human pricing
XM_933895 Rosetta Predictions human pricing
XM_933898 Rosetta Predictions human pricing
XM_933902 Rosetta Predictions human pricing
XM_933906 Rosetta Predictions human pricing
XM_933909 Rosetta Predictions human pricing
XM_933912 Rosetta Predictions human pricing
XM_933915 Rosetta Predictions human pricing
XM_933920 Rosetta Predictions human pricing
XM_933922 Rosetta Predictions human pricing
XM_933926 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362753 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296764 predicted 4488
2 SASI_Hs01_00296765 predicted 5802
3 SASI_Hs01_00296766 predicted 5631
4 SASI_Hs01_00296767 predicted 5630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298301 predicted 1277
2 SASI_Hs01_00298302 predicted 1324
3 SASI_Hs01_00298303 predicted 1278
4 SASI_Hs01_00298304 predicted 1353
5 SASI_Hs01_00298305 predicted 1346
6 SASI_Hs01_00298306 predicted 1285
7 SASI_Hs01_00298307 predicted 114
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294692 predicted 1473
2 SASI_Hs01_00294693 predicted 1739
3 SASI_Hs01_00294694 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260316 predicted 1221
2 SASI_Hs01_00260317 predicted 1489
3 SASI_Hs01_00260318 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297468 predicted 3664
2 SASI_Hs01_00297469 predicted 3486
3 SASI_Hs01_00297470 predicted 3491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283136 predicted 2023
2 SASI_Hs01_00283137 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294906 predicted 4086
2 SASI_Hs01_00294907 predicted 3917
3 SASI_Hs01_00294908 predicted 3916
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251439 predicted 4642
2 SASI_Hs01_00251440 predicted 4471
3 SASI_Hs01_00251441 predicted 4471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300491 predicted 4881
2 SASI_Hs01_00300492 predicted 4710
3 SASI_Hs01_00300493 predicted 4709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260229 predicted 5210
2 SASI_Hs01_00260230 predicted 5043
3 SASI_Hs01_00260231 predicted 5045
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277027 predicted 248
2 SASI_Hs01_00277028 predicted 267
3 SASI_Hs01_00277029 predicted 916
4 SASI_Hs01_00277030 predicted 278
5 SASI_Hs01_00277031 predicted 237
6 SASI_Hs01_00277032 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265658 predicted 713
2 SASI_Hs01_00265659 predicted 720
3 SASI_Hs01_00265660 predicted 699
4 SASI_Hs01_00265661 predicted 742
5 SASI_Hs01_00265662 predicted 1394
6 SASI_Hs01_00265663 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279808 predicted 4495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266479 predicted 858
2 SASI_Hs01_00266480 predicted 868
3 SASI_Hs01_00266481 predicted 854
4 SASI_Hs01_00266482 predicted 892
5 SASI_Hs01_00266483 predicted 1550
6 SASI_Hs01_00266484 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279427 predicted 1544
2 SASI_Hs01_00279428 predicted 1556
3 SASI_Hs01_00279429 predicted 1540
4 SASI_Hs01_00279430 predicted 1578
5 SASI_Hs01_00279431 predicted 2225
6 SASI_Hs01_00279432 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280192 predicted 2420
2 SASI_Hs01_00280193 predicted 2441
3 SASI_Hs01_00280194 predicted 2430
4 SASI_Hs01_00280195 predicted 2410
5 SASI_Hs01_00280196 predicted 3095
6 SASI_Hs01_00280197 predicted 2454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285668 predicted 2556
2 SASI_Hs01_00285669 predicted 2564
3 SASI_Hs01_00285670 predicted 2763
4 SASI_Hs01_00285671 predicted 2724
5 SASI_Hs01_00285672 predicted 2577
6 SASI_Hs01_00285673 predicted 2548
7 SASI_Hs01_00285674 predicted 3043
8 SASI_Hs01_00285675 predicted 2996
9 SASI_Hs01_00285676 predicted 2789
10 SASI_Hs01_00285677 predicted 2588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263510 predicted 2814
2 SASI_Hs01_00263511 predicted 2827
3 SASI_Hs01_00263512 predicted 3014
4 SASI_Hs01_00263513 predicted 2979
5 SASI_Hs01_00263514 predicted 2837
6 SASI_Hs01_00263515 predicted 2810
7 SASI_Hs01_00263516 predicted 3296
8 SASI_Hs01_00263517 predicted 3259
9 SASI_Hs01_00263518 predicted 3044
10 SASI_Hs01_00263519 predicted 2844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268635 predicted 7792
2 SASI_Hs01_00268636 predicted 7627
3 SASI_Hs01_00268637 predicted 7621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288230 predicted 7904
2 SASI_Hs01_00288231 predicted 7736
3 SASI_Hs01_00288232 predicted 7733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280426 predicted 7114
2 SASI_Hs01_00280427 predicted 7127
3 SASI_Hs01_00280428 predicted 7316
4 SASI_Hs01_00280429 predicted 7285
5 SASI_Hs01_00280430 predicted 7133
6 SASI_Hs01_00280431 predicted 7107
7 SASI_Hs01_00280432 predicted 7344
8 SASI_Hs01_00280433 predicted 7150
9 SASI_Hs01_00280434 predicted 7321
10 SASI_Hs01_00280435 predicted 7356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297987 predicted 6293
2 SASI_Hs01_00297988 predicted 6310
3 SASI_Hs01_00297989 predicted 6499
4 SASI_Hs01_00297990 predicted 6466
5 SASI_Hs01_00297991 predicted 6319
6 SASI_Hs01_00297992 predicted 6293
7 SASI_Hs01_00297993 predicted 6529
8 SASI_Hs01_00297994 predicted 6329
9 SASI_Hs01_00297995 predicted 6501
10 SASI_Hs01_00297996 predicted 6538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279433 predicted 7769
2 SASI_Hs01_00279434 predicted 7731
3 SASI_Hs01_00279435 predicted 7735
4 SASI_Hs01_00279436 predicted 7719
5 SASI_Hs01_00279437 predicted 7758
6 SASI_Hs01_00279438 predicted 7743
7 SASI_Hs01_00279439 predicted 7714
8 SASI_Hs01_00279440 predicted 7726
9 SASI_Hs01_00279441 predicted 7763
10 SASI_Hs01_00279442 predicted 7709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272007 predicted 8091
2 SASI_Hs01_00272008 predicted 8093
3 SASI_Hs01_00272009 predicted 8093
4 SASI_Hs01_00272010 predicted 7772
5 SASI_Hs01_00272011 predicted 7726
6 SASI_Hs01_00272012 predicted 7739
7 SASI_Hs01_00272013 predicted 7720
8 SASI_Hs01_00272014 predicted 7757
9 SASI_Hs01_00272015 predicted 7747
10 SASI_Hs01_00272016 predicted 7712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267513 predicted 7432
2 SASI_Hs01_00267514 predicted 7441
3 SASI_Hs01_00267515 predicted 7449
4 SASI_Hs01_00267516 predicted 7422
5 SASI_Hs01_00267517 predicted 7466
6 SASI_Hs01_00267518 predicted 7465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256009 predicted 8512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260113 predicted 7734
2 SASI_Hs01_00260114 predicted 7734
3 SASI_Hs01_00260115 predicted 7753
4 SASI_Hs01_00260116 predicted 7725
5 SASI_Hs01_00260117 predicted 7756
6 SASI_Hs01_00260118 predicted 7759
7 SASI_Hs01_00260119 predicted 9606
8 SASI_Hs01_00260120 predicted 9604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266197 predicted 7727
2 SASI_Hs01_00266198 predicted 7744
3 SASI_Hs01_00266199 predicted 7761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269900 predicted 11286
2 SASI_Hs01_00269901 predicted 11106
3 SASI_Hs01_00269902 predicted 11111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290957 predicted 7724
2 SASI_Hs01_00290958 predicted 7734
3 SASI_Hs01_00290959 predicted 7751
4 SASI_Hs01_00290960 predicted 7717
5 SASI_Hs01_00290961 predicted 7761
6 SASI_Hs01_00290962 predicted 7763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248263 predicted 11743
2 SASI_Hs01_00248264 predicted 11568
3 SASI_Hs01_00248265 predicted 11570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288779 predicted 7724
2 SASI_Hs01_00288780 predicted 7734
3 SASI_Hs01_00288781 predicted 7747
4 SASI_Hs01_00288782 predicted 7725
5 SASI_Hs01_00288783 predicted 7754
6 SASI_Hs01_00288784 predicted 7765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248398 predicted 7445
2 SASI_Hs01_00248399 predicted 7456
3 SASI_Hs01_00248400 predicted 7651
4 SASI_Hs01_00248401 predicted 7611
5 SASI_Hs01_00248402 predicted 7465
6 SASI_Hs01_00248403 predicted 7442
7 SASI_Hs01_00248404 predicted 7674
8 SASI_Hs01_00248405 predicted 7475
9 SASI_Hs01_00248406 predicted 7646
10 SASI_Hs01_00248407 predicted 7679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250143 predicted 7733
2 SASI_Hs01_00250144 predicted 7734
3 SASI_Hs01_00250145 predicted 7934
4 SASI_Hs01_00250146 predicted 7954
5 SASI_Hs01_00250147 predicted 7756
6 SASI_Hs01_00250148 predicted 7897
7 SASI_Hs01_00250149 predicted 7747
8 SASI_Hs01_00250150 predicted 7931
9 SASI_Hs01_00250151 predicted 7966
10 SASI_Hs01_00250152 predicted 7718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281092 predicted 12531
2 SASI_Hs01_00281093 predicted 12365
3 SASI_Hs01_00281094 predicted 12355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268950 predicted 7900
2 SASI_Hs01_00268951 predicted 7914
3 SASI_Hs01_00268952 predicted 8110
4 SASI_Hs01_00268953 predicted 8072
5 SASI_Hs01_00268954 predicted 7926
6 SASI_Hs01_00268955 predicted 7895
7 SASI_Hs01_00268956 predicted 8126
8 SASI_Hs01_00268957 predicted 7929
9 SASI_Hs01_00268958 predicted 8103
10 SASI_Hs01_00268959 predicted 8145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270817 predicted 7567
2 SASI_Hs01_00270818 predicted 7570
3 SASI_Hs01_00270819 predicted 7769
4 SASI_Hs01_00270820 predicted 7731
5 SASI_Hs01_00270821 predicted 7581
6 SASI_Hs01_00270822 predicted 7564
7 SASI_Hs01_00270823 predicted 7794
8 SASI_Hs01_00270824 predicted 7595
9 SASI_Hs01_00270825 predicted 7759
10 SASI_Hs01_00270826 predicted 7800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281987 predicted 12463
2 SASI_Hs01_00281988 predicted 12283
3 SASI_Hs01_00281989 predicted 12279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256836 predicted 7731
2 SASI_Hs01_00256837 predicted 7737
3 SASI_Hs01_00256838 predicted 7927
4 SASI_Hs01_00256839 predicted 7897
5 SASI_Hs01_00256840 predicted 7743
6 SASI_Hs01_00256841 predicted 7719
7 SASI_Hs01_00256842 predicted 7959
8 SASI_Hs01_00256843 predicted 7758
9 SASI_Hs01_00256844 predicted 7924
10 SASI_Hs01_00256845 predicted 7961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288558 predicted 7602
2 SASI_Hs01_00288559 predicted 7602
3 SASI_Hs01_00288560 predicted 7586
4 SASI_Hs01_00288561 predicted 7628
5 SASI_Hs01_00288562 predicted 7630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260680 predicted 7734
2 SASI_Hs01_00260681 predicted 7733
3 SASI_Hs01_00260682 predicted 7932
4 SASI_Hs01_00260683 predicted 7900
5 SASI_Hs01_00260684 predicted 7752
6 SASI_Hs01_00260685 predicted 7727
7 SASI_Hs01_00260686 predicted 7955
8 SASI_Hs01_00260687 predicted 7755
9 SASI_Hs01_00260688 predicted 7922
10 SASI_Hs01_00260689 predicted 7969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130464
NPIPB3 MISSION shRNA Bacterial Glycerol Stock
nuclear pore complex interacting protein family, member B3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-486s21c1
Sequence:CCGGTTGGCCTGAAAGACGTCATTACTCGAGTAATGACGTCTTTCAGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-269s21c1
Sequence:CCGGATTGCGTTTCCGACAAGTTATCTCGAGATAACTTGTCGGAAACGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-298s21c1
Sequence:CCGGCATTACCCTCTGGATAGTTTACTCGAGTAAACTATCCAGAGGGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-898s21c1
Sequence:CCGGTCCACCCTCAGCGGATGATAACTCGAGTTATCATCCGCTGAGGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-1711s21c1
Sequence:CCGGTCCACCCTCAGCCGATGATAACTCGAGTTATCATCGGCTGAGGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130464
NPIPB3 MISSION shRNA shRNA Plasmid DNA
nuclear pore complex interacting protein family, member B3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-486s21c1
Sequence:CCGGTTGGCCTGAAAGACGTCATTACTCGAGTAATGACGTCTTTCAGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-269s21c1
Sequence:CCGGATTGCGTTTCCGACAAGTTATCTCGAGATAACTTGTCGGAAACGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-298s21c1
Sequence:CCGGCATTACCCTCTGGATAGTTTACTCGAGTAAACTATCCAGAGGGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-898s21c1
Sequence:CCGGTCCACCCTCAGCGGATGATAACTCGAGTTATCATCCGCTGAGGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-1711s21c1
Sequence:CCGGTCCACCCTCAGCCGATGATAACTCGAGTTATCATCGGCTGAGGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130464
NPIPB3 MISSION shRNA Lentiviral Transduction Particles
nuclear pore complex interacting protein family, member B3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-486s21c1
Sequence:CCGGTTGGCCTGAAAGACGTCATTACTCGAGTAATGACGTCTTTCAGGCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-269s21c1
Sequence:CCGGATTGCGTTTCCGACAAGTTATCTCGAGATAACTTGTCGGAAACGCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-298s21c1
Sequence:CCGGCATTACCCTCTGGATAGTTTACTCGAGTAAACTATCCAGAGGGTAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-898s21c1
Sequence:CCGGTCCACCCTCAGCGGATGATAACTCGAGTTATCATCCGCTGAGGGTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130464.1-1711s21c1
Sequence:CCGGTCCACCCTCAGCCGATGATAACTCGAGTTATCATCGGCTGAGGGTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???