EMAIL THIS PAGE TO A FRIEND

NPIPB7

nuclear pore complex interacting protein family, member B7

23 Gene Product Result for
Synonyms: A-575C2.4 A-761H5.5 NPIPL1
Species: Human NPIPB7(440350)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018122 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103891 MISSION® esiRNA esiRNA human AL158212.15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018122 Rosetta Predictions human pricing
XM_001713614 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307037 predicted 731
2 SASI_Hs02_00307038 predicted 721
3 SASI_Hs02_00307039 predicted 707
4 SASI_Hs02_00307040 predicted 729
5 SASI_Hs02_00307041 predicted 942
6 SASI_Hs02_00307042 predicted 833
7 SASI_Hs02_00307043 predicted 835
8 SASI_Hs02_00307044 predicted 783
9 SASI_Hs02_00307045 predicted 581
10 SASI_Hs02_00307046 predicted 854
11 SASI_Hs01_00110640 predicted 23
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392423 predicted 647
2 SASI_Hs02_00392424 predicted 666
3 SASI_Hs02_00392425 predicted 205
4 SASI_Hs02_00392426 predicted 396
5 SASI_Hs02_00392427 predicted 425
6 SASI_Hs02_00392428 predicted 618
7 SASI_Hs02_00392429 predicted 700
8 SASI_Hs02_00392430 predicted 199
9 SASI_Hs02_00392431 predicted 521
10 SASI_Hs02_00392432 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018122
NPIPB7 MISSION shRNA Bacterial Glycerol Stock
nuclear pore complex interacting protein family, member B7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-64s1c1
Sequence:CCGGCCTGTGTCTTTCCTGAAGACTCTCGAGAGTCTTCAGGAAAGACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-202s1c1
Sequence:CCGGGTTTCTTCCTTTCGAGGAAATCTCGAGATTTCCTCGAAAGGAAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018122.1-1002s1c1
Sequence:CCGGGCCATGCCTAAGTGACTTCTTCTCGAGAAGAAGTCACTTAGGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-232s1c1
Sequence:CCGGCTGAAAGACGTCATTACTCTACTCGAGTAGAGTAATGACGTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018122.1-775s1c1
Sequence:CCGGCCTTAAATGATGCTCAGCTAACTCGAGTTAGCTGAGCATCATTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-241s1c1
Sequence:CCGGGTCATTACTCTACGGAGGCATCTCGAGATGCCTCCGTAGAGTAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018122
NPIPB7 MISSION shRNA shRNA Plasmid DNA
nuclear pore complex interacting protein family, member B7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-64s1c1
Sequence:CCGGCCTGTGTCTTTCCTGAAGACTCTCGAGAGTCTTCAGGAAAGACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-202s1c1
Sequence:CCGGGTTTCTTCCTTTCGAGGAAATCTCGAGATTTCCTCGAAAGGAAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018122.1-1002s1c1
Sequence:CCGGGCCATGCCTAAGTGACTTCTTCTCGAGAAGAAGTCACTTAGGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-232s1c1
Sequence:CCGGCTGAAAGACGTCATTACTCTACTCGAGTAGAGTAATGACGTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018122.1-775s1c1
Sequence:CCGGCCTTAAATGATGCTCAGCTAACTCGAGTTAGCTGAGCATCATTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-241s1c1
Sequence:CCGGGTCATTACTCTACGGAGGCATCTCGAGATGCCTCCGTAGAGTAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018122
NPIPB7 MISSION shRNA Lentiviral Transduction Particles
nuclear pore complex interacting protein family, member B7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-64s1c1
Sequence:CCGGCCTGTGTCTTTCCTGAAGACTCTCGAGAGTCTTCAGGAAAGACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-202s1c1
Sequence:CCGGGTTTCTTCCTTTCGAGGAAATCTCGAGATTTCCTCGAAAGGAAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018122.1-1002s1c1
Sequence:CCGGGCCATGCCTAAGTGACTTCTTCTCGAGAAGAAGTCACTTAGGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-232s1c1
Sequence:CCGGCTGAAAGACGTCATTACTCTACTCGAGTAGAGTAATGACGTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018122.1-775s1c1
Sequence:CCGGCCTTAAATGATGCTCAGCTAACTCGAGTTAGCTGAGCATCATTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018122.1-241s1c1
Sequence:CCGGGTCATTACTCTACGGAGGCATCTCGAGATGCCTCCGTAGAGTAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)