EMAIL THIS PAGE TO A FRIEND

NPLOC4

nuclear protein localization 4 homolog (S. cerevisiae)

76 Gene Product Result for
Synonyms: NPL4
UniProtKB ID: Q8TAT6, Q8N3J1, Q9H8V2, Q9H964, Q9NWR5, Q9P229
Gene ID:
Mouse(217365) nuclear protein localization 4 homolog (S. cerevisiae)
Rat(140639) nuclear protein localization 4 homolog (S. cerevisiae)
Zebrafish(327447) nuclear protein localization 4 homolog (S. cerevisiae)
chicken(417456) nuclear protein localization 4 homolog (S. cerevisiae)
dog(483363) nuclear protein localization 4 homolog (S. cerevisiae)
domestic cat(101097934) nuclear protein localization 4 homolog (S. cerevisiae)
cow(508519) nuclear protein localization 4 homolog (S. cerevisiae)
Horse(100055877) nuclear protein localization 4 homolog (S. cerevisiae)
sheep(101108846) nuclear protein localization 4 homolog (S. cerevisiae)
domestic guinea pig(100735532) nuclear protein localization 4 homolog (S. cerevisiae)
naked mole-rat(101704760) nuclear protein localization 4 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017921 Rosetta Predictions human pricing
NM_080577 Rosetta Predictions rat pricing
NM_199469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121677 predicted 1549
2 SASI_Hs02_00350914 predicted 992
3 SASI_Hs02_00350915 predicted 517
4 SASI_Hs01_00121679 predicted 358
5 SASI_Hs01_00121680 predicted 1462
6 SASI_Hs02_00350916 predicted 1008
7 SASI_Hs01_00121681 predicted 1655
8 SASI_Hs01_00121682 predicted 1720
9 SASI_Hs01_00121683 predicted 612
10 SASI_Hs01_00121685 predicted 357
11 SASI_Hs01_00121678 predicted 957
12 SASI_Hs01_00121684 predicted 1132
13 SASI_Hs01_00121686 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031507 predicted 1694
2 SASI_Rn01_00031508 predicted 1440
3 SASI_Rn02_00267240 predicted 984
4 SASI_Rn01_00031509 predicted 1276
5 SASI_Rn01_00031510 predicted 828
6 SASI_Rn01_00031512 predicted 818
7 SASI_Rn01_00031513 predicted 884
8 SASI_Rn01_00031514 predicted 459
9 SASI_Rn01_00031515 predicted 946
10 SASI_Rn02_00267241 predicted 1286
11 SASI_Rn01_00031506 predicted 336
12 SASI_Rn01_00031511 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059686 predicted 332
2 SASI_Mm01_00059687 predicted 1529
3 SASI_Mm01_00059688 predicted 1439
4 SASI_Mm01_00059689 predicted 1712
5 SASI_Mm01_00059690 predicted 700
6 SASI_Mm01_00059691 predicted 976
7 SASI_Mm01_00059692 predicted 1406
8 SASI_Mm01_00059693 predicted 466
9 SASI_Mm02_00351476 predicted 1599
10 SASI_Mm01_00059695 predicted 1279
11 SASI_Mm01_00059694 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017921
VALIDATED
NPLOC4 MISSION shRNA Bacterial Glycerol Stock
nuclear protein localization 4 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017921.2-620s21c1
Sequence:CCGGATTCGATGAGGACTATCTAAACTCGAGTTTAGATAGTCCTCATCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-1098s21c1
Sequence:CCGGCGGAAGGTTGGCTGGATATTTCTCGAGAAATATCCAGCCAACCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017921.2-1308s21c1
Sequence:CCGGCCTGACAACCAAGTCCACTTTCTCGAGAAAGTGGACTTGGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-2357s21c1
Sequence:CCGGCCACCCAGCCTTCTCTTTATTCTCGAGAATAAAGAGAAGGCTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-1154s21c1
Sequence:CCGGCGTCCGCTACAGTCGAAATAACTCGAGTTATTTCGACTGTAGCGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3279s1c1
Sequence:CCGGCCACATTCTTGGCACTATGAACTCGAGTTCATAGTGCCAAGAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3861s1c1
Sequence:CCGGGCATTGGCGATTTGTCTGATTCTCGAGAATCAGACAAATCGCCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1261s1c1
Sequence:CCGGGACAACCAAGTCCACTTTGAACTCGAGTTCAAAGTGGACTTGGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017921.1-3290s1c1
Sequence:CCGGGCACTATGAACAGAGAACATTCTCGAGAATGTTCTCTGTTCATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1601s1c1
Sequence:CCGGCCTATTTGTCTCAGAATACCTCTCGAGAGGTATTCTGAGACAAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3867s1c1
Sequence:CCGGGCGATTTGTCTGATTCTGGTTCTCGAGAACCAGAATCAGACAAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1009s1c1
Sequence:CCGGGCTGAAGTGGTCGATGAAATTCTCGAGAATTTCATCGACCACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-1258s1c1
Sequence:CCGGCCTGACAACCAAGTCCACTTTCTCGAGAAAGTGGACTTGGTTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017921
VALIDATED
NPLOC4 MISSION shRNA shRNA Plasmid DNA
nuclear protein localization 4 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017921.2-620s21c1
Sequence:CCGGATTCGATGAGGACTATCTAAACTCGAGTTTAGATAGTCCTCATCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-1098s21c1
Sequence:CCGGCGGAAGGTTGGCTGGATATTTCTCGAGAAATATCCAGCCAACCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017921.2-1308s21c1
Sequence:CCGGCCTGACAACCAAGTCCACTTTCTCGAGAAAGTGGACTTGGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-2357s21c1
Sequence:CCGGCCACCCAGCCTTCTCTTTATTCTCGAGAATAAAGAGAAGGCTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-1154s21c1
Sequence:CCGGCGTCCGCTACAGTCGAAATAACTCGAGTTATTTCGACTGTAGCGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3279s1c1
Sequence:CCGGCCACATTCTTGGCACTATGAACTCGAGTTCATAGTGCCAAGAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3861s1c1
Sequence:CCGGGCATTGGCGATTTGTCTGATTCTCGAGAATCAGACAAATCGCCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1261s1c1
Sequence:CCGGGACAACCAAGTCCACTTTGAACTCGAGTTCAAAGTGGACTTGGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017921.1-3290s1c1
Sequence:CCGGGCACTATGAACAGAGAACATTCTCGAGAATGTTCTCTGTTCATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1601s1c1
Sequence:CCGGCCTATTTGTCTCAGAATACCTCTCGAGAGGTATTCTGAGACAAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3867s1c1
Sequence:CCGGGCGATTTGTCTGATTCTGGTTCTCGAGAACCAGAATCAGACAAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1009s1c1
Sequence:CCGGGCTGAAGTGGTCGATGAAATTCTCGAGAATTTCATCGACCACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-1258s1c1
Sequence:CCGGCCTGACAACCAAGTCCACTTTCTCGAGAAAGTGGACTTGGTTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017921
VALIDATED
NPLOC4 MISSION shRNA Lentiviral Transduction Particles
nuclear protein localization 4 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017921.2-620s21c1
Sequence:CCGGATTCGATGAGGACTATCTAAACTCGAGTTTAGATAGTCCTCATCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-1098s21c1
Sequence:CCGGCGGAAGGTTGGCTGGATATTTCTCGAGAAATATCCAGCCAACCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017921.2-1308s21c1
Sequence:CCGGCCTGACAACCAAGTCCACTTTCTCGAGAAAGTGGACTTGGTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-2357s21c1
Sequence:CCGGCCACCCAGCCTTCTCTTTATTCTCGAGAATAAAGAGAAGGCTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017921.2-1154s21c1
Sequence:CCGGCGTCCGCTACAGTCGAAATAACTCGAGTTATTTCGACTGTAGCGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3279s1c1
Sequence:CCGGCCACATTCTTGGCACTATGAACTCGAGTTCATAGTGCCAAGAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3861s1c1
Sequence:CCGGGCATTGGCGATTTGTCTGATTCTCGAGAATCAGACAAATCGCCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1261s1c1
Sequence:CCGGGACAACCAAGTCCACTTTGAACTCGAGTTCAAAGTGGACTTGGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017921.1-3290s1c1
Sequence:CCGGGCACTATGAACAGAGAACATTCTCGAGAATGTTCTCTGTTCATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1601s1c1
Sequence:CCGGCCTATTTGTCTCAGAATACCTCTCGAGAGGTATTCTGAGACAAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-3867s1c1
Sequence:CCGGGCGATTTGTCTGATTCTGGTTCTCGAGAACCAGAATCAGACAAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017921.1-1009s1c1
Sequence:CCGGGCTGAAGTGGTCGATGAAATTCTCGAGAATTTCATCGACCACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017921.1-1258s1c1
Sequence:CCGGCCTGACAACCAAGTCCACTTTCTCGAGAAAGTGGACTTGGTTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199469
VALIDATED
NPLOC4 MISSION shRNA Bacterial Glycerol Stock
nuclear protein localization 4 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199469.1-2825s21c1
Sequence:CCGGGCAAATAGAAACAGTCCCTAACTCGAGTTAGGGACTGTTTCTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199469.1-2982s21c1
Sequence:CCGGGCCATGTTTGTCACCTTAGTACTCGAGTACTAAGGTGACAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199469.1-756s21c1
Sequence:CCGGCCAAATGGTATCTGCACCAAACTCGAGTTTGGTGCAGATACCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199469.1-283s21c1
Sequence:CCGGGCTTCTCAGTTTACATCAATACTCGAGTATTGATGTAAACTGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-707s1c1
Sequence:CCGGGAACATCAGCTGCAAGATTAACTCGAGTTAATCTTGCAGCTGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-474s1c1
Sequence:CCGGGAAGATGAGATCGATCAATACCTCGAGGTATTGATCGATCTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-283s1c1
Sequence:CCGGGCTTCTCAGTTTACATCAATACTCGAGTATTGATGTAAACTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-2825s1c1
Sequence:CCGGGCAAATAGAAACAGTCCCTAACTCGAGTTAGGGACTGTTTCTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-756s1c1
Sequence:CCGGCCAAATGGTATCTGCACCAAACTCGAGTTTGGTGCAGATACCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-2982s1c1
Sequence:CCGGGCCATGTTTGTCACCTTAGTACTCGAGTACTAAGGTGACAAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-1281s1c1
Sequence:CCGGCCTGACAACCAGGTTCACTTTCTCGAGAAAGTGAACCTGGTTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199469
VALIDATED
NPLOC4 MISSION shRNA shRNA Plasmid DNA
nuclear protein localization 4 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199469.1-2825s21c1
Sequence:CCGGGCAAATAGAAACAGTCCCTAACTCGAGTTAGGGACTGTTTCTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199469.1-2982s21c1
Sequence:CCGGGCCATGTTTGTCACCTTAGTACTCGAGTACTAAGGTGACAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199469.1-756s21c1
Sequence:CCGGCCAAATGGTATCTGCACCAAACTCGAGTTTGGTGCAGATACCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199469.1-283s21c1
Sequence:CCGGGCTTCTCAGTTTACATCAATACTCGAGTATTGATGTAAACTGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-707s1c1
Sequence:CCGGGAACATCAGCTGCAAGATTAACTCGAGTTAATCTTGCAGCTGATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-474s1c1
Sequence:CCGGGAAGATGAGATCGATCAATACCTCGAGGTATTGATCGATCTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-283s1c1
Sequence:CCGGGCTTCTCAGTTTACATCAATACTCGAGTATTGATGTAAACTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-2825s1c1
Sequence:CCGGGCAAATAGAAACAGTCCCTAACTCGAGTTAGGGACTGTTTCTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-756s1c1
Sequence:CCGGCCAAATGGTATCTGCACCAAACTCGAGTTTGGTGCAGATACCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-2982s1c1
Sequence:CCGGGCCATGTTTGTCACCTTAGTACTCGAGTACTAAGGTGACAAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-1281s1c1
Sequence:CCGGCCTGACAACCAGGTTCACTTTCTCGAGAAAGTGAACCTGGTTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199469
VALIDATED
NPLOC4 MISSION shRNA Lentiviral Transduction Particles
nuclear protein localization 4 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199469.1-2825s21c1
Sequence:CCGGGCAAATAGAAACAGTCCCTAACTCGAGTTAGGGACTGTTTCTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199469.1-2982s21c1
Sequence:CCGGGCCATGTTTGTCACCTTAGTACTCGAGTACTAAGGTGACAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199469.1-756s21c1
Sequence:CCGGCCAAATGGTATCTGCACCAAACTCGAGTTTGGTGCAGATACCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199469.1-283s21c1
Sequence:CCGGGCTTCTCAGTTTACATCAATACTCGAGTATTGATGTAAACTGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-707s1c1
Sequence:CCGGGAACATCAGCTGCAAGATTAACTCGAGTTAATCTTGCAGCTGATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-474s1c1
Sequence:CCGGGAAGATGAGATCGATCAATACCTCGAGGTATTGATCGATCTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-283s1c1
Sequence:CCGGGCTTCTCAGTTTACATCAATACTCGAGTATTGATGTAAACTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-2825s1c1
Sequence:CCGGGCAAATAGAAACAGTCCCTAACTCGAGTTAGGGACTGTTTCTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-756s1c1
Sequence:CCGGCCAAATGGTATCTGCACCAAACTCGAGTTTGGTGCAGATACCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199469.1-2982s1c1
Sequence:CCGGGCCATGTTTGTCACCTTAGTACTCGAGTACTAAGGTGACAAACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199469.1-1281s1c1
Sequence:CCGGCCTGACAACCAGGTTCACTTTCTCGAGAAAGTGAACCTGGTTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)