EMAIL THIS PAGE TO A FRIEND

NPM1

nucleophosmin (nucleolar phosphoprotein B23, numatrin)

113 Gene Product Result for
Synonyms: B23 NPM
Gene ID:
Human(4869) Summary: This gene encodes a phosphoprotein which moves between the nucleus and the cytoplasm. The gene product is thought to be involved in several processes including regulation of the ARF/p53 pathway. A number of genes are fusion partners have been characterized, in particular the anaplastic lymphoma kinase gene on chromosome 2. Mutations in this gene are associated with acute myeloid leukemia. More than a dozen pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
Mouse(18148) nucleophosmin 1
Rat(25498) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
chicken(396203) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
domestic cat(101094904) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
cow(614028) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
dog(479292) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
naked mole-rat(101701761) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Domestic Rabbit(100328693) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
domestic guinea pig(101788218) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
sheep(101104783) nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B0556 Anti-B23 antibody, Mouse monoclonal clone FC82291, purified from hybridoma cell culture hamster, bovine, kangaroo rat, monkey, mouse, human, canine, rat
ELISA, immunocytochemistry, immunoprecipitation (IP), western blot pricing
AV34094 Anti-NPM1 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, rabbit, rat, dog, mouse, human, pig
immunohistochemistry, western blot pricing
AV34095 Anti-NPM1 (AB2) antibody produced in rabbit IgG fraction of antiserum goat, human, rabbit, dog, horse, rat, bovine, mouse, pig
immunohistochemistry, western blot pricing
HPA011384 Anti-NPM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5500154 Anti-Nucleophosmin antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP236, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB2500710 Anti-Nucleophosmin/NPM1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4504047 Anti-phospho-NPM (pThr199) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0004869M1 Monoclonal Anti-NPM1 antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404143 Monoclonal Anti-NPM1 antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0252 Rabbit anti-NPM1 Antibody, Affinity Purified mouse, human
proximity ligation assay, western blot pricing
PLA0253 Rabbit anti-NPM1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002520 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037738 Rosetta Predictions human pricing
NM_002520 Rosetta Predictions human pricing
NM_199185 Rosetta Predictions human pricing
NM_012992 Rosetta Predictions rat pricing
NM_008722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308362 predicted 259
2 SASI_Hs02_00308363 predicted 989
3 SASI_Hs01_00214118 predicted 951
4 SASI_Hs02_00308364 predicted 589
5 SASI_Hs01_00214119 predicted 985
6 SASI_Hs02_00308365 predicted 311
7 SASI_Hs02_00308366 predicted 341
8 SASI_Hs01_00214120 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333989 predicted 262
2 SASI_Hs02_00333990 predicted 594
3 SASI_Hs02_00333991 predicted 308
4 SASI_Hs02_00333992 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372634 predicted 259
2 SASI_Hs02_00372635 predicted 725
3 SASI_Hs02_00372636 predicted 590
4 SASI_Hs02_00372637 predicted 312
5 SASI_Hs02_00372638 predicted 339
6 SASI_Hs01_00034469 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260634 predicted 1000
2 SASI_Rn01_00069137 predicted 957
3 SASI_Rn01_00069138 predicted 862
4 SASI_Rn01_00069139 predicted 886
5 SASI_Rn01_00069140 predicted 1011
6 SASI_Rn01_00069141 predicted 989
7 SASI_Rn01_00069142 predicted 1025
8 SASI_Rn01_00069143 predicted 928
9 SASI_Rn01_00069144 predicted 1065
10 SASI_Rn01_00069145 predicted 888
11 SASI_Rn01_00069146 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314563 predicted 984
2 SASI_Mm02_00314564 predicted 255
3 SASI_Mm02_00314565 predicted 273
4 SASI_Mm02_00314566 predicted 276
5 SASI_Mm02_00314567 predicted 899
6 SASI_Mm02_00314568 predicted 292
7 SASI_Mm01_00177892 predicted 1003
8 SASI_Mm02_00314569 predicted 204
9 SASI_Mm02_00314570 predicted 1035
10 SASI_Mm02_00314571 predicted 901
11 SASI_Mm01_00177893 predicted 720
12 SASI_Mm01_00177894 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002520
VALIDATED
NPM1 MISSION shRNA Bacterial Glycerol Stock
nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002520.5-1135s21c1
Sequence:CCGGGAACTTTCCCTACCGTGTTTGCTCGAGCAAACACGGTAGGGAAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-1120s1c1
Sequence:CCGGGCCAAGAATGTGTTGTCCAAACTCGAGTTTGGACAACACATTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-664s1c1
Sequence:CCGGGCGCCAGTGAAGAAATCTATACTCGAGTATAGATTTCTTCACTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-253s1c1
Sequence:CCGGGCAAAGGATGAGTTGCACATTCTCGAGAATGTGCAACTCATCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-817s1c1
Sequence:CCGGCCTAGTTCTGTAGAAGACATTCTCGAGAATGTCTTCTACAGAACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-169s1c1
Sequence:CCGGGCCGACAAAGATTATCACTTTCTCGAGAAAGTGATAATCTTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-469s21c1
Sequence:CCGGGTTCAGGGCCAGTGCATATTACTCGAGTAATATGCACTGGCCCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002520.5-876s21c1
Sequence:CCGGCCTAGTTCTGTAGAAGACATTCTCGAGAATGTCTTCTACAGAACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-723s21c1
Sequence:CCGGGCGCCAGTGAAGAAATCTATACTCGAGTATAGATTTCTTCACTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-353s21c1
Sequence:CCGGTTACGAAGGCAGTCCAATTAACTCGAGTTAATTGGACTGCCTTCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002520
VALIDATED
NPM1 MISSION shRNA shRNA Plasmid DNA
nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002520.5-1135s21c1
Sequence:CCGGGAACTTTCCCTACCGTGTTTGCTCGAGCAAACACGGTAGGGAAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-1120s1c1
Sequence:CCGGGCCAAGAATGTGTTGTCCAAACTCGAGTTTGGACAACACATTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-664s1c1
Sequence:CCGGGCGCCAGTGAAGAAATCTATACTCGAGTATAGATTTCTTCACTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-253s1c1
Sequence:CCGGGCAAAGGATGAGTTGCACATTCTCGAGAATGTGCAACTCATCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-817s1c1
Sequence:CCGGCCTAGTTCTGTAGAAGACATTCTCGAGAATGTCTTCTACAGAACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-169s1c1
Sequence:CCGGGCCGACAAAGATTATCACTTTCTCGAGAAAGTGATAATCTTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-469s21c1
Sequence:CCGGGTTCAGGGCCAGTGCATATTACTCGAGTAATATGCACTGGCCCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002520.5-876s21c1
Sequence:CCGGCCTAGTTCTGTAGAAGACATTCTCGAGAATGTCTTCTACAGAACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-723s21c1
Sequence:CCGGGCGCCAGTGAAGAAATCTATACTCGAGTATAGATTTCTTCACTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-353s21c1
Sequence:CCGGTTACGAAGGCAGTCCAATTAACTCGAGTTAATTGGACTGCCTTCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002520
VALIDATED
NPM1 MISSION shRNA Lentiviral Transduction Particles
nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002520.5-1135s21c1
Sequence:CCGGGAACTTTCCCTACCGTGTTTGCTCGAGCAAACACGGTAGGGAAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-1120s1c1
Sequence:CCGGGCCAAGAATGTGTTGTCCAAACTCGAGTTTGGACAACACATTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-664s1c1
Sequence:CCGGGCGCCAGTGAAGAAATCTATACTCGAGTATAGATTTCTTCACTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-253s1c1
Sequence:CCGGGCAAAGGATGAGTTGCACATTCTCGAGAATGTGCAACTCATCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-817s1c1
Sequence:CCGGCCTAGTTCTGTAGAAGACATTCTCGAGAATGTCTTCTACAGAACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002520.4-169s1c1
Sequence:CCGGGCCGACAAAGATTATCACTTTCTCGAGAAAGTGATAATCTTTGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-469s21c1
Sequence:CCGGGTTCAGGGCCAGTGCATATTACTCGAGTAATATGCACTGGCCCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002520.5-876s21c1
Sequence:CCGGCCTAGTTCTGTAGAAGACATTCTCGAGAATGTCTTCTACAGAACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-723s21c1
Sequence:CCGGGCGCCAGTGAAGAAATCTATACTCGAGTATAGATTTCTTCACTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002520.5-353s21c1
Sequence:CCGGTTACGAAGGCAGTCCAATTAACTCGAGTTAATTGGACTGCCTTCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008722
VALIDATED
NPM1 MISSION shRNA Bacterial Glycerol Stock
nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-262s1c1
Sequence:CCGGGCAGAAGCAATGAACTATGAACTCGAGTTCATAGTTCATTGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-1087s1c1
Sequence:CCGGGCCAAGAATGTGTTGTCTAAACTCGAGTTTAGACAACACATTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-445s1c1
Sequence:CCGGGCAGAGTCTGAAGATGAAGATCTCGAGATCTTCATCTTCAGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-151s1c1
Sequence:CCGGGCTGACAAAGACTATCACTTTCTCGAGAAAGTGATAGTCTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-936s1c1
Sequence:CCGGGCAGTGGAGGAAATCTCTTTACTCGAGTAAAGAGATTTCCTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008722.2-1086s21c1
Sequence:CCGGGCCAAGAATGTGTTGTCTAAACTCGAGTTTAGACAACACATTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-261s21c1
Sequence:CCGGGCAGAAGCAATGAACTATGAACTCGAGTTCATAGTTCATTGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-444s21c1
Sequence:CCGGGCAGAGTCTGAAGATGAAGATCTCGAGATCTTCATCTTCAGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-150s21c1
Sequence:CCGGGCTGACAAAGACTATCACTTTCTCGAGAAAGTGATAGTCTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008722
VALIDATED
NPM1 MISSION shRNA shRNA Plasmid DNA
nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-262s1c1
Sequence:CCGGGCAGAAGCAATGAACTATGAACTCGAGTTCATAGTTCATTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-1087s1c1
Sequence:CCGGGCCAAGAATGTGTTGTCTAAACTCGAGTTTAGACAACACATTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-445s1c1
Sequence:CCGGGCAGAGTCTGAAGATGAAGATCTCGAGATCTTCATCTTCAGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-151s1c1
Sequence:CCGGGCTGACAAAGACTATCACTTTCTCGAGAAAGTGATAGTCTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-936s1c1
Sequence:CCGGGCAGTGGAGGAAATCTCTTTACTCGAGTAAAGAGATTTCCTCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008722.2-1086s21c1
Sequence:CCGGGCCAAGAATGTGTTGTCTAAACTCGAGTTTAGACAACACATTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-261s21c1
Sequence:CCGGGCAGAAGCAATGAACTATGAACTCGAGTTCATAGTTCATTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-444s21c1
Sequence:CCGGGCAGAGTCTGAAGATGAAGATCTCGAGATCTTCATCTTCAGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-150s21c1
Sequence:CCGGGCTGACAAAGACTATCACTTTCTCGAGAAAGTGATAGTCTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008722
VALIDATED
NPM1 MISSION shRNA Lentiviral Transduction Particles
nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-262s1c1
Sequence:CCGGGCAGAAGCAATGAACTATGAACTCGAGTTCATAGTTCATTGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-1087s1c1
Sequence:CCGGGCCAAGAATGTGTTGTCTAAACTCGAGTTTAGACAACACATTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-445s1c1
Sequence:CCGGGCAGAGTCTGAAGATGAAGATCTCGAGATCTTCATCTTCAGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-151s1c1
Sequence:CCGGGCTGACAAAGACTATCACTTTCTCGAGAAAGTGATAGTCTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008722.1-936s1c1
Sequence:CCGGGCAGTGGAGGAAATCTCTTTACTCGAGTAAAGAGATTTCCTCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008722.2-1086s21c1
Sequence:CCGGGCCAAGAATGTGTTGTCTAAACTCGAGTTTAGACAACACATTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-261s21c1
Sequence:CCGGGCAGAAGCAATGAACTATGAACTCGAGTTCATAGTTCATTGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-444s21c1
Sequence:CCGGGCAGAGTCTGAAGATGAAGATCTCGAGATCTTCATCTTCAGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008722.2-150s21c1
Sequence:CCGGGCTGACAAAGACTATCACTTTCTCGAGAAAGTGATAGTCTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)