EMAIL THIS PAGE TO A FRIEND

NPPA

natriuretic peptide A

82 Gene Product Result for
Synonyms: ANF ANP ATFB6 CDD-ANF PND
UniProtKB ID: P01160, Q13766, Q5JZE1
Gene ID:
Human(4878) Summary: The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. [provided by RefSeq, Sep 2009]
Mouse(230899) natriuretic peptide type A
Rat(24602) natriuretic peptide A
Zebrafish(321442) natriuretic peptide precursor A
dog(608289) natriuretic peptide A
domestic cat(101100575) natriuretic peptide A
cow(281355) natriuretic peptide A
Horse(100034201) natriuretic peptide A
sheep(100294648) natriuretic peptide A
naked mole-rat(101718417) natriuretic peptide A
Domestic Rabbit(100009087) natriuretic peptide A
domestic guinea pig(100135578) natriuretic peptide A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153391 MISSION® esiRNA targeting human NPPA human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006172 Rosetta Predictions human pricing
NM_012612 Rosetta Predictions rat pricing
NM_008725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341030 predicted 198
2 SASI_Hs01_00101566 predicted 404
3 SASI_Hs01_00101568 predicted 200
4 SASI_Hs01_00101570 predicted 389
5 SASI_Hs01_00101571 predicted 512
6 SASI_Hs02_00341031 predicted 266
7 SASI_Hs01_00101572 predicted 529
8 SASI_Hs01_00101573 predicted 453
9 SASI_Hs01_00101574 predicted 453
10 SASI_Hs02_00341032 predicted 492
11 SASI_Hs01_00101565 predicted 206
12 SASI_Hs01_00101567 predicted 200
13 SASI_Hs01_00101569 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064259 predicted 227
2 SASI_Rn01_00064261 predicted 217
3 SASI_Rn01_00064263 predicted 490
4 SASI_Rn01_00064267 predicted 288
5 SASI_Rn02_00259803 predicted 380
6 SASI_Rn01_00064268 predicted 383
7 SASI_Rn02_00259804 predicted 519
8 SASI_Rn02_00259805 predicted 476
9 SASI_Rn02_00259806 predicted 588
10 SASI_Rn02_00259807 predicted 530
11 SASI_Rn01_00064260 predicted 325
12 SASI_Rn01_00064262 predicted 504
13 SASI_Rn01_00064264 predicted 334
14 SASI_Rn01_00064265 predicted 503
15 SASI_Rn01_00064266 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189354 predicted 348
2 SASI_Mm01_00189355 predicted 233
3 SASI_Mm01_00189356 predicted 523
4 SASI_Mm01_00189357 predicted 262
5 SASI_Mm01_00189358 predicted 523
6 SASI_Mm01_00189359 predicted 559
7 SASI_Mm01_00189360 predicted 399
8 SASI_Mm01_00189361 predicted 556
9 SASI_Mm02_00314573 predicted 258
10 SASI_Mm01_00189362 predicted 339
11 SASI_Mm01_00189363 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006172
NPPA MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-201s1c1
Sequence:CCGGCGCAGACCTGATGGATTTCAACTCGAGTTGAAATCCATCAGGTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-632s1c1
Sequence:CCGGGCTGCATTTGTGTCATCTTGTCTCGAGACAAGATGACACAAATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-249s1c1
Sequence:CCGGGATGCCTTTAGAAGATGAGGTCTCGAGACCTCATCTTCTAAAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-695s1c1
Sequence:CCGGGTCAACACTTCTCACATCTTACTCGAGTAAGATGTGAGAAGTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-633s1c1
Sequence:CCGGCTGCATTTGTGTCATCTTGTTCTCGAGAACAAGATGACACAAATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-222s1c1
Sequence:CCGGGAATTTGCTGGACCATTTGGACTCGAGTCCAAATGGTCCAGCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-168s1c1
Sequence:CCGGCAGAGCTAATCCCATGTACAACTCGAGTTGTACATGGGATTAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-253s1c1
Sequence:CCGGCCTTTAGAAGATGAGGTCGTGCTCGAGCACGACCTCATCTTCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-167s1c1
Sequence:CCGGCCAGAGCTAATCCCATGTACACTCGAGTGTACATGGGATTAGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-180s1c1
Sequence:CCGGCATGTACAATGCCGTGTCCAACTCGAGTTGGACACGGCATTGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006172
NPPA MISSION shRNA shRNA Plasmid DNA
natriuretic peptide A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-201s1c1
Sequence:CCGGCGCAGACCTGATGGATTTCAACTCGAGTTGAAATCCATCAGGTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-632s1c1
Sequence:CCGGGCTGCATTTGTGTCATCTTGTCTCGAGACAAGATGACACAAATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-249s1c1
Sequence:CCGGGATGCCTTTAGAAGATGAGGTCTCGAGACCTCATCTTCTAAAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-695s1c1
Sequence:CCGGGTCAACACTTCTCACATCTTACTCGAGTAAGATGTGAGAAGTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-633s1c1
Sequence:CCGGCTGCATTTGTGTCATCTTGTTCTCGAGAACAAGATGACACAAATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-222s1c1
Sequence:CCGGGAATTTGCTGGACCATTTGGACTCGAGTCCAAATGGTCCAGCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-168s1c1
Sequence:CCGGCAGAGCTAATCCCATGTACAACTCGAGTTGTACATGGGATTAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-253s1c1
Sequence:CCGGCCTTTAGAAGATGAGGTCGTGCTCGAGCACGACCTCATCTTCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-167s1c1
Sequence:CCGGCCAGAGCTAATCCCATGTACACTCGAGTGTACATGGGATTAGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-180s1c1
Sequence:CCGGCATGTACAATGCCGTGTCCAACTCGAGTTGGACACGGCATTGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006172
NPPA MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-201s1c1
Sequence:CCGGCGCAGACCTGATGGATTTCAACTCGAGTTGAAATCCATCAGGTCTGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000154738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-632s1c1
Sequence:CCGGGCTGCATTTGTGTCATCTTGTCTCGAGACAAGATGACACAAATGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000154839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-249s1c1
Sequence:CCGGGATGCCTTTAGAAGATGAGGTCTCGAGACCTCATCTTCTAAAGGCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000150540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-695s1c1
Sequence:CCGGGTCAACACTTCTCACATCTTACTCGAGTAAGATGTGAGAAGTGTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000151808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006172.1-633s1c1
Sequence:CCGGCTGCATTTGTGTCATCTTGTTCTCGAGAACAAGATGACACAAATGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-222s1c1
Sequence:CCGGGAATTTGCTGGACCATTTGGACTCGAGTCCAAATGGTCCAGCAAATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-168s1c1
Sequence:CCGGCAGAGCTAATCCCATGTACAACTCGAGTTGTACATGGGATTAGCTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-253s1c1
Sequence:CCGGCCTTTAGAAGATGAGGTCGTGCTCGAGCACGACCTCATCTTCTAAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-167s1c1
Sequence:CCGGCCAGAGCTAATCCCATGTACACTCGAGTGTACATGGGATTAGCTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006172.1-180s1c1
Sequence:CCGGCATGTACAATGCCGTGTCCAACTCGAGTTGGACACGGCATTGTACATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008725
NPPA MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-402s21c1
Sequence:CCGGGATAGATCTGCCCTCTTGAAACTCGAGTTTCAAGAGGGCAGATCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-228s21c1
Sequence:CCGGGAGGAGAAGATGCCGGTAGAACTCGAGTTCTACCGGCATCTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-136s21c1
Sequence:CCGGTTTGGCTTCCAGGCCATATTGCTCGAGCAATATGGCCTGGAAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008725.2-619s21c1
Sequence:CCGGTCACGCAGCTTGGTCACATTGCTCGAGCAATGTGACCAAGCTGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-185s21c1
Sequence:CCGGCAACACAGATCTGATGGATTTCTCGAGAAATCCATCAGATCTGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008725
NPPA MISSION shRNA shRNA Plasmid DNA
natriuretic peptide A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-402s21c1
Sequence:CCGGGATAGATCTGCCCTCTTGAAACTCGAGTTTCAAGAGGGCAGATCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-228s21c1
Sequence:CCGGGAGGAGAAGATGCCGGTAGAACTCGAGTTCTACCGGCATCTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-136s21c1
Sequence:CCGGTTTGGCTTCCAGGCCATATTGCTCGAGCAATATGGCCTGGAAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008725.2-619s21c1
Sequence:CCGGTCACGCAGCTTGGTCACATTGCTCGAGCAATGTGACCAAGCTGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-185s21c1
Sequence:CCGGCAACACAGATCTGATGGATTTCTCGAGAAATCCATCAGATCTGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008725
NPPA MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-402s21c1
Sequence:CCGGGATAGATCTGCCCTCTTGAAACTCGAGTTTCAAGAGGGCAGATCTATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-228s21c1
Sequence:CCGGGAGGAGAAGATGCCGGTAGAACTCGAGTTCTACCGGCATCTTCTCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000258187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-136s21c1
Sequence:CCGGTTTGGCTTCCAGGCCATATTGCTCGAGCAATATGGCCTGGAAGCCAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008725.2-619s21c1
Sequence:CCGGTCACGCAGCTTGGTCACATTGCTCGAGCAATGTGACCAAGCTGCGTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008725.2-185s21c1
Sequence:CCGGCAACACAGATCTGATGGATTTCTCGAGAAATCCATCAGATCTGTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???