EMAIL THIS PAGE TO A FRIEND

NPPB

natriuretic peptide B

66 Gene Product Result for
Synonyms: BNP
UniProtKB ID: P16860, B0ZBE9, Q6FGY0, Q9P2Q7
Gene ID:
Human(4879) Summary: This gene is a member of the natriuretic peptide family and encodes a secreted protein which functions as a cardiac hormone. The protein undergoes two cleavage events, one within the cell and a second after secretion into the blood. The protein's biological actions include natriuresis, diuresis, vasorelaxation, inhibition of renin and aldosterone secretion, and a key role in cardiovascular homeostasis. A high concentration of this protein in the bloodstream is indicative of heart failure. Mutations in this gene have been associated with postmenopausal osteoporosis. [provided by RefSeq, Jul 2008]
Mouse(18158) natriuretic peptide type B
Rat(25105) natriuretic peptide B
chicken(395765) natriuretic peptide B
dog(487441) natriuretic peptide B
cow(508734) natriuretic peptide B
domestic cat(493764) natriuretic peptide B
naked mole-rat(101718083) natriuretic peptide B
sheep(100294642) natriuretic peptide B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU218411 MISSION® esiRNA targeting mouse Nppb mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002521 Rosetta Predictions human pricing
NM_031545 Rosetta Predictions rat pricing
NM_008726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032229 predicted 356
2 SASI_Hs01_00032230 predicted 353
3 SASI_Hs01_00032231 predicted 349
4 SASI_Hs01_00032232 predicted 413
5 SASI_Hs01_00032233 predicted 449
6 SASI_Hs01_00032234 predicted 311
7 SASI_Hs01_00032235 predicted 377
8 SASI_Hs01_00032236 predicted 433
9 SASI_Hs01_00032237 predicted 309
10 SASI_Hs01_00032238 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038479 predicted 271
2 SASI_Rn01_00038480 predicted 217
3 SASI_Rn01_00038481 predicted 220
4 SASI_Rn01_00038482 predicted 265
5 SASI_Rn01_00038483 predicted 240
6 SASI_Rn01_00038485 predicted 595
7 SASI_Rn02_00264718 predicted 551
8 SASI_Rn01_00038486 predicted 311
9 SASI_Rn01_00038488 predicted 582
10 SASI_Rn02_00264719 predicted 392
11 SASI_Rn01_00038484 predicted 211
12 SASI_Rn01_00038487 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314574 predicted 277
2 SASI_Mm01_00155906 predicted 397
3 SASI_Mm02_00314575 predicted 246
4 SASI_Mm01_00155908 predicted 312
5 SASI_Mm02_00314576 predicted 202
6 SASI_Mm01_00155909 predicted 317
7 SASI_Mm01_00155910 predicted 343
8 SASI_Mm02_00314577 predicted 249
9 SASI_Mm02_00314578 predicted 265
10 SASI_Mm02_00314579 predicted 276
11 SASI_Mm01_00155907 predicted 264
12 SASI_Mm01_00155911 predicted 241
13 SASI_Mm01_00155912 predicted 258
14 SASI_Mm01_00155913 predicted 216
15 SASI_Mm01_00155914 predicted 233
16 SASI_Mm01_00155915 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008726
VALIDATED
NPPB MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008726.4-532s21c1
Sequence:CCGGTAACGCACTGAAGTTGTTGTACTCGAGTACAACAACTTCAGTGCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008726.2-516s1c1
Sequence:CCGGCCACCTTTGAAGTGATCCTATCTCGAGATAGGATCACTTCAAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008726.2-188s1c1
Sequence:CCGGCAGAGCAATTCAAGATGCAGACTCGAGTCTGCATCTTGAATTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-480s21c1
Sequence:CCGGGCTGCTTTGGGCACAAGATAGCTCGAGCTATCTTGTGCCCAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-283s21c1
Sequence:CCGGTAGCCAGTCTCCAGAGCAATTCTCGAGAATTGCTCTGGAGACTGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008726.4-625s21c1
Sequence:CCGGCCTTTGAAGTGATCCTATTTACTCGAGTAAATAGGATCACTTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-506s21c1
Sequence:CCGGATCGGATCCGTCAGTCGTTTGCTCGAGCAAACGACTGACGGATCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008726.2-422s1c1
Sequence:CCGGGCTGTAACGCACTGAAGTTGTCTCGAGACAACTTCAGTGCGTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008726
VALIDATED
NPPB MISSION shRNA shRNA Plasmid DNA
natriuretic peptide B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008726.4-532s21c1
Sequence:CCGGTAACGCACTGAAGTTGTTGTACTCGAGTACAACAACTTCAGTGCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008726.2-516s1c1
Sequence:CCGGCCACCTTTGAAGTGATCCTATCTCGAGATAGGATCACTTCAAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008726.2-188s1c1
Sequence:CCGGCAGAGCAATTCAAGATGCAGACTCGAGTCTGCATCTTGAATTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-480s21c1
Sequence:CCGGGCTGCTTTGGGCACAAGATAGCTCGAGCTATCTTGTGCCCAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-283s21c1
Sequence:CCGGTAGCCAGTCTCCAGAGCAATTCTCGAGAATTGCTCTGGAGACTGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008726.4-625s21c1
Sequence:CCGGCCTTTGAAGTGATCCTATTTACTCGAGTAAATAGGATCACTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-506s21c1
Sequence:CCGGATCGGATCCGTCAGTCGTTTGCTCGAGCAAACGACTGACGGATCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008726.2-422s1c1
Sequence:CCGGGCTGTAACGCACTGAAGTTGTCTCGAGACAACTTCAGTGCGTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008726
VALIDATED
NPPB MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008726.4-532s21c1
Sequence:CCGGTAACGCACTGAAGTTGTTGTACTCGAGTACAACAACTTCAGTGCGTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008726.2-516s1c1
Sequence:CCGGCCACCTTTGAAGTGATCCTATCTCGAGATAGGATCACTTCAAAGGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008726.2-188s1c1
Sequence:CCGGCAGAGCAATTCAAGATGCAGACTCGAGTCTGCATCTTGAATTGCTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-480s21c1
Sequence:CCGGGCTGCTTTGGGCACAAGATAGCTCGAGCTATCTTGTGCCCAAAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-283s21c1
Sequence:CCGGTAGCCAGTCTCCAGAGCAATTCTCGAGAATTGCTCTGGAGACTGGCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008726.4-625s21c1
Sequence:CCGGCCTTTGAAGTGATCCTATTTACTCGAGTAAATAGGATCACTTCAAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008726.4-506s21c1
Sequence:CCGGATCGGATCCGTCAGTCGTTTGCTCGAGCAAACGACTGACGGATCCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008726.2-422s1c1
Sequence:CCGGGCTGTAACGCACTGAAGTTGTCTCGAGACAACTTCAGTGCGTTACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002521
NPPB MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-486s21c1
Sequence:CCGGCAAAGTGCTGAGGCGGCATTACTCGAGTAATGCCGCCTCAGCACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-231s21c1
Sequence:CCGGACAGGAGCAGCGCAACCATTTCTCGAGAAATGGTTGCGCTGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-145s21c1
Sequence:CCGGCTCTTCTTGCATCTGGCTTTCCTCGAGGAAAGCCAGATGCAAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-201s21c1
Sequence:CCGGTTCAGCCTCGGACTTGGAAACCTCGAGGTTTCCAAGTCCGAGGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002521.2-523s21c1
Sequence:CCGGGCAGACACCTGCTTCTGATTCCTCGAGGAATCAGAAGCAGGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002521
NPPB MISSION shRNA shRNA Plasmid DNA
natriuretic peptide B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-486s21c1
Sequence:CCGGCAAAGTGCTGAGGCGGCATTACTCGAGTAATGCCGCCTCAGCACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-231s21c1
Sequence:CCGGACAGGAGCAGCGCAACCATTTCTCGAGAAATGGTTGCGCTGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-145s21c1
Sequence:CCGGCTCTTCTTGCATCTGGCTTTCCTCGAGGAAAGCCAGATGCAAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-201s21c1
Sequence:CCGGTTCAGCCTCGGACTTGGAAACCTCGAGGTTTCCAAGTCCGAGGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002521.2-523s21c1
Sequence:CCGGGCAGACACCTGCTTCTGATTCCTCGAGGAATCAGAAGCAGGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002521
NPPB MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-486s21c1
Sequence:CCGGCAAAGTGCTGAGGCGGCATTACTCGAGTAATGCCGCCTCAGCACTTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-231s21c1
Sequence:CCGGACAGGAGCAGCGCAACCATTTCTCGAGAAATGGTTGCGCTGCTCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-145s21c1
Sequence:CCGGCTCTTCTTGCATCTGGCTTTCCTCGAGGAAAGCCAGATGCAAGAAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002521.2-201s21c1
Sequence:CCGGTTCAGCCTCGGACTTGGAAACCTCGAGGTTTCCAAGTCCGAGGCTGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002521.2-523s21c1
Sequence:CCGGGCAGACACCTGCTTCTGATTCCTCGAGGAATCAGAAGCAGGTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???