EMAIL THIS PAGE TO A FRIEND

NPPC

natriuretic peptide C

101 Gene Product Result for
Synonyms: CNP CNP2
UniProtKB ID: P23582, Q4ZG41
Gene ID:
Human(4880) Summary: The protein encoded by this gene is proteolytically processed to form a secreted hormone of the natriuretic peptide family. The encoded hormone regulates the growth and differentiation of cartilaginous growth plate chondrocytes and may also be vasoactive and natriuretic. [provided by RefSeq, Sep 2011]
Mouse(18159) natriuretic peptide type C
Rat(114593) natriuretic peptide C
Goat(100861580) natriuretic peptide C
sheep(493773) natriuretic peptide C
naked mole-rat(101703963) natriuretic peptide C
domestic guinea pig(100734369) natriuretic peptide C
chicken(419487) natriuretic peptide C
dog(610169) natriuretic peptide C
domestic cat(101097827) natriuretic peptide C
cow(281356) natriuretic peptide C
domestic cat(493771) natriuretic peptide C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024409 Rosetta Predictions human pricing
NM_053750 Rosetta Predictions rat pricing
NM_010933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198077 predicted 326
2 SASI_Hs01_00198078 predicted 249
3 SASI_Hs01_00198079 predicted 293
4 SASI_Hs02_00356711 predicted 241
5 SASI_Hs01_00198080 predicted 178
6 SASI_Hs02_00356712 predicted 216
7 SASI_Hs01_00198081 predicted 344
8 SASI_Hs01_00198082 predicted 244
9 SASI_Hs01_00198083 predicted 133
10 SASI_Hs01_00198084 predicted 244
11 SASI_Hs01_00198085 predicted 147
12 SASI_Hs01_00198086 predicted 46
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072897 predicted 247
2 SASI_Rn01_00072898 predicted 290
3 SASI_Rn01_00072899 predicted 243
4 SASI_Rn01_00072900 predicted 355
5 SASI_Rn01_00072901 predicted 243
6 SASI_Rn02_00266535 predicted 357
7 SASI_Rn01_00072902 predicted 248
8 SASI_Rn01_00072903 predicted 242
9 SASI_Rn01_00072904 predicted 366
10 SASI_Rn01_00072905 predicted 355
11 SASI_Rn01_00072896 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022266 predicted 374
2 SASI_Mm01_00022267 predicted 255
3 SASI_Mm01_00022268 predicted 312
4 SASI_Mm01_00022269 predicted 261
5 SASI_Mm01_00022270 predicted 345
6 SASI_Mm01_00022271 predicted 383
7 SASI_Mm01_00022272 predicted 258
8 SASI_Mm01_00022273 predicted 212
9 SASI_Mm01_00022274 predicted 328
10 SASI_Mm01_00022275 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010933
NPPC MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-424s1c1
Sequence:CCGGGCAAATACAAAGGCGGCAACACTCGAGTGTTGCCGCCTTTGTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-440s1c1
Sequence:CCGGCAACAAGAAGGGCTTGTCCAACTCGAGTTGGACAAGCCCTTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-425s1c1
Sequence:CCGGCAAATACAAAGGCGGCAACAACTCGAGTTGTTGCCGCCTTTGTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010933.2-862s1c1
Sequence:CCGGGCTGTTTGTAAATTCACGTCACTCGAGTGACGTGAATTTACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010933
NPPC MISSION shRNA shRNA Plasmid DNA
natriuretic peptide C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-424s1c1
Sequence:CCGGGCAAATACAAAGGCGGCAACACTCGAGTGTTGCCGCCTTTGTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-440s1c1
Sequence:CCGGCAACAAGAAGGGCTTGTCCAACTCGAGTTGGACAAGCCCTTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-425s1c1
Sequence:CCGGCAAATACAAAGGCGGCAACAACTCGAGTTGTTGCCGCCTTTGTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010933.2-862s1c1
Sequence:CCGGGCTGTTTGTAAATTCACGTCACTCGAGTGACGTGAATTTACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010933
NPPC MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-424s1c1
Sequence:CCGGGCAAATACAAAGGCGGCAACACTCGAGTGTTGCCGCCTTTGTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-440s1c1
Sequence:CCGGCAACAAGAAGGGCTTGTCCAACTCGAGTTGGACAAGCCCTTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010933.2-425s1c1
Sequence:CCGGCAAATACAAAGGCGGCAACAACTCGAGTTGTTGCCGCCTTTGTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010933.2-862s1c1
Sequence:CCGGGCTGTTTGTAAATTCACGTCACTCGAGTGACGTGAATTTACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)