EMAIL THIS PAGE TO A FRIEND

NPR1

natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)

50 Gene Product Result for
Synonyms: ANPRA ANPa GUC2A GUCY2A NPRA
UniProtKB ID: P16066, B0ZBF0, Q5SR08, Q6P4Q3
Gene ID:
Human(4881) Summary: Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]
Mouse(18160) natriuretic peptide receptor 1
Rat(24603) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Thale Cress(842733) Regulatory protein NPR1
cow(533048) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Horse(100061959) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
domestic cat(101080682) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
chicken(431640) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
dog(490455) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
domestic guinea pig(100728832) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
naked mole-rat(101714641) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Domestic Rabbit(100343663) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
sheep(101123436) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
sheep(100294649) natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000906 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000906 siRNAs that have been validated in the lab human pricing
NM_012613 Rosetta Predictions rat pricing
NM_008727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000906 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234789 validated 2281
2 SASI_Hs01_00234786 predicted 2379
3 SASI_Hs01_00234787 predicted 2173
4 SASI_Hs01_00234788 predicted 2156
5 SASI_Hs01_00234790 predicted 1389
6 SASI_Hs01_00234791 predicted 1634
7 SASI_Hs02_00303474 predicted 1784
8 SASI_Hs01_00234794 predicted 3454
9 SASI_Hs01_00234795 predicted 1660
10 SASI_Hs02_00303475 predicted 2028
11 SASI_Hs01_00234792 predicted 3481
12 SASI_Hs01_00234793 predicted 3753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042262 predicted 3327
2 SASI_Rn01_00042263 predicted 1305
3 SASI_Rn01_00042264 predicted 1815
4 SASI_Rn02_00259808 predicted 2089
5 SASI_Rn01_00042267 predicted 848
6 SASI_Rn01_00042268 predicted 2058
7 SASI_Rn01_00042269 predicted 2234
8 SASI_Rn01_00042270 predicted 2126
9 SASI_Rn01_00042271 predicted 1072
10 SASI_Rn02_00259809 predicted 1568
11 SASI_Rn01_00042265 predicted 1719
12 SASI_Rn01_00042266 predicted 2522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106966 predicted 3320
2 SASI_Mm01_00106967 predicted 2953
3 SASI_Mm01_00106968 predicted 1704
4 SASI_Mm01_00106969 predicted 2081
5 SASI_Mm01_00106970 predicted 2226
6 SASI_Mm02_00314580 predicted 2957
7 SASI_Mm01_00106972 predicted 2046
8 SASI_Mm01_00106973 predicted 1067
9 SASI_Mm01_00106974 predicted 1347
10 SASI_Mm01_00106975 predicted 2265
11 SASI_Mm01_00106971 predicted 1275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008727
NPR1 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-1288s21c1
Sequence:CCGGACTTACAAAGAACCCGATAATCTCGAGATTATCGGGTTCTTTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-2009s21c1
Sequence:CCGGTTGCCAAGACAGCATACTATACTCGAGTATAGTATGCTGTCTTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-1813s21c1
Sequence:CCGGATCGTGTCTTTCTTCATATACCTCGAGGTATATGAAGAAAGACACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-1691s1c1
Sequence:CCGGCCCTAAATGTGGCTTTGACAACTCGAGTTGTCAAAGCCACATTTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-962s1c1
Sequence:CCGGGCGACTCAACATCACAGTAAACTCGAGTTTACTGTGATGTTGAGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-2738s1c1
Sequence:CCGGGCGCAAGTTCAACAAGGAGAACTCGAGTTCTCCTTGTTGAACTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-3339s1c1
Sequence:CCGGGCTTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-1638s1c1
Sequence:CCGGGCTGTGTCAGAACACAGATTACTCGAGTAATCTGTGTTCTGACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008727
NPR1 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-1288s21c1
Sequence:CCGGACTTACAAAGAACCCGATAATCTCGAGATTATCGGGTTCTTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-2009s21c1
Sequence:CCGGTTGCCAAGACAGCATACTATACTCGAGTATAGTATGCTGTCTTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-1813s21c1
Sequence:CCGGATCGTGTCTTTCTTCATATACCTCGAGGTATATGAAGAAAGACACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-1691s1c1
Sequence:CCGGCCCTAAATGTGGCTTTGACAACTCGAGTTGTCAAAGCCACATTTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-962s1c1
Sequence:CCGGGCGACTCAACATCACAGTAAACTCGAGTTTACTGTGATGTTGAGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-2738s1c1
Sequence:CCGGGCGCAAGTTCAACAAGGAGAACTCGAGTTCTCCTTGTTGAACTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-3339s1c1
Sequence:CCGGGCTTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-1638s1c1
Sequence:CCGGGCTGTGTCAGAACACAGATTACTCGAGTAATCTGTGTTCTGACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008727
NPR1 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-1288s21c1
Sequence:CCGGACTTACAAAGAACCCGATAATCTCGAGATTATCGGGTTCTTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-2009s21c1
Sequence:CCGGTTGCCAAGACAGCATACTATACTCGAGTATAGTATGCTGTCTTGGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008727.5-1813s21c1
Sequence:CCGGATCGTGTCTTTCTTCATATACCTCGAGGTATATGAAGAAAGACACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-1691s1c1
Sequence:CCGGCCCTAAATGTGGCTTTGACAACTCGAGTTGTCAAAGCCACATTTAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-962s1c1
Sequence:CCGGGCGACTCAACATCACAGTAAACTCGAGTTTACTGTGATGTTGAGTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-2738s1c1
Sequence:CCGGGCGCAAGTTCAACAAGGAGAACTCGAGTTCTCCTTGTTGAACTTGCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-3339s1c1
Sequence:CCGGGCTTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008727.4-1638s1c1
Sequence:CCGGGCTGTGTCAGAACACAGATTACTCGAGTAATCTGTGTTCTGACACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000906
VALIDATED
NPR1 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000906.3-3700s21c1
Sequence:CCGGGCCAAAGGATGGAAGTAATTTCTCGAGAAATTACTTCCATCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000906.2-2862s1c1
Sequence:CCGGCGCCTGACGTTGCGCAAATTTCTCGAGAAATTTGCGCAACGTCAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000906.2-3981s1c1
Sequence:CCGGCCCTCAGCCTTGCTACCCTGTCTCGAGACAGGGTAGCAAGGCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-3149s21c1
Sequence:CCGGGCTGTCATAGACAACTTTGATCTCGAGATCAAAGTTGTCTATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000906.2-3771s1c1
Sequence:CCGGGAATAGCTCAGGTGTGCTTACCTCGAGGTAAGCACACCTGAGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3750s1c1
Sequence:CCGGGCCAAAGGATGGAAGTAATTTCTCGAGAAATTACTTCCATCCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-1633s1c1
Sequence:CCGGGCTTTCAAGGTGTGACAGGATCTCGAGATCCTGTCACACCTTGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-3425s21c1
Sequence:CCGGGCCTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-1584s21c1
Sequence:CCGGGCTTTCAAGGTGTGACAGGATCTCGAGATCCTGTCACACCTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3474s1c1
Sequence:CCGGGCCTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000906.3-2814s21c1
Sequence:GTACCGGGCCTGACGTTGCGCAAATTTACTCGAGTAAATTTGCGCAACGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3198s1c1
Sequence:CCGGGCTGTCATAGACAACTTTGATCTCGAGATCAAAGTTGTCTATGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000906.2-1418s1c1
Sequence:CCGGCCCAGATAATCCCGAGTACTTCTCGAGAAGTACTCGGGATTATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000906
VALIDATED
NPR1 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000906.3-3700s21c1
Sequence:CCGGGCCAAAGGATGGAAGTAATTTCTCGAGAAATTACTTCCATCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000906.2-2862s1c1
Sequence:CCGGCGCCTGACGTTGCGCAAATTTCTCGAGAAATTTGCGCAACGTCAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000906.2-3981s1c1
Sequence:CCGGCCCTCAGCCTTGCTACCCTGTCTCGAGACAGGGTAGCAAGGCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-3149s21c1
Sequence:CCGGGCTGTCATAGACAACTTTGATCTCGAGATCAAAGTTGTCTATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000906.2-3771s1c1
Sequence:CCGGGAATAGCTCAGGTGTGCTTACCTCGAGGTAAGCACACCTGAGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3750s1c1
Sequence:CCGGGCCAAAGGATGGAAGTAATTTCTCGAGAAATTACTTCCATCCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-1633s1c1
Sequence:CCGGGCTTTCAAGGTGTGACAGGATCTCGAGATCCTGTCACACCTTGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-3425s21c1
Sequence:CCGGGCCTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-1584s21c1
Sequence:CCGGGCTTTCAAGGTGTGACAGGATCTCGAGATCCTGTCACACCTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3474s1c1
Sequence:CCGGGCCTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000906.3-2814s21c1
Sequence:GTACCGGGCCTGACGTTGCGCAAATTTACTCGAGTAAATTTGCGCAACGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3198s1c1
Sequence:CCGGGCTGTCATAGACAACTTTGATCTCGAGATCAAAGTTGTCTATGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000906.2-1418s1c1
Sequence:CCGGCCCAGATAATCCCGAGTACTTCTCGAGAAGTACTCGGGATTATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000906
VALIDATED
NPR1 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000906.3-3700s21c1
Sequence:CCGGGCCAAAGGATGGAAGTAATTTCTCGAGAAATTACTTCCATCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000906.2-2862s1c1
Sequence:CCGGCGCCTGACGTTGCGCAAATTTCTCGAGAAATTTGCGCAACGTCAGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000906.2-3981s1c1
Sequence:CCGGCCCTCAGCCTTGCTACCCTGTCTCGAGACAGGGTAGCAAGGCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-3149s21c1
Sequence:CCGGGCTGTCATAGACAACTTTGATCTCGAGATCAAAGTTGTCTATGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000906.2-3771s1c1
Sequence:CCGGGAATAGCTCAGGTGTGCTTACCTCGAGGTAAGCACACCTGAGCTATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3750s1c1
Sequence:CCGGGCCAAAGGATGGAAGTAATTTCTCGAGAAATTACTTCCATCCTTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-1633s1c1
Sequence:CCGGGCTTTCAAGGTGTGACAGGATCTCGAGATCCTGTCACACCTTGAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-3425s21c1
Sequence:CCGGGCCTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000906.3-1584s21c1
Sequence:CCGGGCTTTCAAGGTGTGACAGGATCTCGAGATCCTGTCACACCTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3474s1c1
Sequence:CCGGGCCTCAAGAATGGAGTCTAATCTCGAGATTAGACTCCATTCTTGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000906.3-2814s21c1
Sequence:GTACCGGGCCTGACGTTGCGCAAATTTACTCGAGTAAATTTGCGCAACGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000906.2-3198s1c1
Sequence:CCGGGCTGTCATAGACAACTTTGATCTCGAGATCAAAGTTGTCTATGACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000906.2-1418s1c1
Sequence:CCGGCCCAGATAATCCCGAGTACTTCTCGAGAAGTACTCGGGATTATCTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)