EMAIL THIS PAGE TO A FRIEND

NPR2

natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)

68 Gene Product Result for
Synonyms: AMDM ANPRB ANPb GUC2B GUCY2B NPRB NPRBi
Gene ID:
Human(4882) Summary: This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
Mouse(230103) natriuretic peptide receptor 2
Rat(116564) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
chicken(100859339) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
dog(474762) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Horse(100055416) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
cow(281357) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
domestic cat(101094301) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Goat(100861577) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
sheep(101112950) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
naked mole-rat(101712380) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
domestic guinea pig(100732021) natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000907 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003995 Rosetta Predictions human pricing
NM_053838 Rosetta Predictions rat pricing
NM_173788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217023 predicted 873
2 SASI_Hs01_00217024 predicted 1120
3 SASI_Hs02_00336713 predicted 903
4 SASI_Hs01_00217025 predicted 523
5 SASI_Hs01_00217026 predicted 1385
6 SASI_Hs01_00217028 predicted 2118
7 SASI_Hs01_00217030 predicted 2212
8 SASI_Hs01_00217031 predicted 461
9 SASI_Hs02_00336714 predicted 2244
10 SASI_Hs01_00217032 predicted 3088
11 SASI_Hs01_00217027 predicted 1583
12 SASI_Hs01_00217029 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266685 predicted 1136
2 SASI_Rn01_00080179 predicted 1878
3 SASI_Rn01_00080181 predicted 575
4 SASI_Rn01_00080183 predicted 526
5 SASI_Rn01_00080184 predicted 266
6 SASI_Rn01_00080185 predicted 2289
7 SASI_Rn02_00266686 predicted 1456
8 SASI_Rn01_00080186 predicted 2862
9 SASI_Rn01_00080187 predicted 1224
10 SASI_Rn01_00080188 predicted 1787
11 SASI_Rn01_00080180 predicted 2326
12 SASI_Rn01_00080182 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201357 predicted 1116
2 SASI_Mm01_00201358 predicted 3214
3 SASI_Mm01_00201359 predicted 1314
4 SASI_Mm01_00201360 predicted 2056
5 SASI_Mm02_00345436 predicted 2500
6 SASI_Mm01_00201361 predicted 3035
7 SASI_Mm01_00201362 predicted 1159
8 SASI_Mm01_00201363 predicted 751
9 SASI_Mm01_00201364 predicted 3340
10 SASI_Mm01_00201365 predicted 438
11 SASI_Mm01_00201366 predicted 2415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003995
VALIDATED
NPR2 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2349s21c1
Sequence:GTACCGGGGGCTTCATTCGGCGCTTTAACTCGAGTTAAAGCGCCGAATGAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-1013s21c1
Sequence:CCGGATGATGGGATCCTGCTATATGCTCGAGCATATAGCAGGATCCCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003995.3-3208s21c1
Sequence:CCGGATGTCTGCACACACCAGAAATCTCGAGATTTCTGGTGTGTGCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-1844s21c1
Sequence:CCGGTGGACTGGATGTTTCGTTATTCTCGAGAATAACGAAACATCCAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2651s21c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-389s21c1
Sequence:CCGGCGGCTAAGAATGACCATTATCCTCGAGGATAATGGTCATTCTTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2791s21c1
Sequence:GTACCGGGCTCGTATGGCCCTAGCATTACTCGAGTAATGCTAGGGCCATACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003995.3-3297s21c1
Sequence:GTACCGGGCAGCTCAGCCCTGTACATATCTCGAGATATGTACAGGGCTGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-2965s1c1
Sequence:CCGGCGAATGGAGTCTAATGGTCAACTCGAGTTGACCATTAGACTCCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-2494s1c1
Sequence:CCGGGCTCTGCTCTACCAAATCCTACTCGAGTAGGATTTGGTAGAGCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-1894s1c1
Sequence:CCGGGCCTTTCTCCACAACAGCATTCTCGAGAATGCTGTTGTGGAGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003995.x-2651s1c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-1801s1c1
Sequence:CCGGCGTGGGAGTTTACAGGATATTCTCGAGAATATCCTGTAAACTCCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003995.3-2222s1c1
Sequence:CCGGGAAATGGTCAGCGGCCATATTCTCGAGAATATGGCCGCTGACCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003995.3-2329s1c1
Sequence:CCGGCCAGACTTTGGACAGATTAAGCTCGAGCTTAATCTGTCCAAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003995.3-3158s1c1
Sequence:CCGGCCAAGTCAGATAGTCTTCTGCCTCGAGGCAGAAGACTATCTGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003995
VALIDATED
NPR2 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2349s21c1
Sequence:GTACCGGGGGCTTCATTCGGCGCTTTAACTCGAGTTAAAGCGCCGAATGAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-1013s21c1
Sequence:CCGGATGATGGGATCCTGCTATATGCTCGAGCATATAGCAGGATCCCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003995.3-3208s21c1
Sequence:CCGGATGTCTGCACACACCAGAAATCTCGAGATTTCTGGTGTGTGCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-1844s21c1
Sequence:CCGGTGGACTGGATGTTTCGTTATTCTCGAGAATAACGAAACATCCAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2651s21c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-389s21c1
Sequence:CCGGCGGCTAAGAATGACCATTATCCTCGAGGATAATGGTCATTCTTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2791s21c1
Sequence:GTACCGGGCTCGTATGGCCCTAGCATTACTCGAGTAATGCTAGGGCCATACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003995.3-3297s21c1
Sequence:GTACCGGGCAGCTCAGCCCTGTACATATCTCGAGATATGTACAGGGCTGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-2965s1c1
Sequence:CCGGCGAATGGAGTCTAATGGTCAACTCGAGTTGACCATTAGACTCCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-2494s1c1
Sequence:CCGGGCTCTGCTCTACCAAATCCTACTCGAGTAGGATTTGGTAGAGCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-1894s1c1
Sequence:CCGGGCCTTTCTCCACAACAGCATTCTCGAGAATGCTGTTGTGGAGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003995.x-2651s1c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-1801s1c1
Sequence:CCGGCGTGGGAGTTTACAGGATATTCTCGAGAATATCCTGTAAACTCCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003995.3-2222s1c1
Sequence:CCGGGAAATGGTCAGCGGCCATATTCTCGAGAATATGGCCGCTGACCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003995.3-2329s1c1
Sequence:CCGGCCAGACTTTGGACAGATTAAGCTCGAGCTTAATCTGTCCAAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003995.3-3158s1c1
Sequence:CCGGCCAAGTCAGATAGTCTTCTGCCTCGAGGCAGAAGACTATCTGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003995
VALIDATED
NPR2 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2349s21c1
Sequence:GTACCGGGGGCTTCATTCGGCGCTTTAACTCGAGTTAAAGCGCCGAATGAAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-1013s21c1
Sequence:CCGGATGATGGGATCCTGCTATATGCTCGAGCATATAGCAGGATCCCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003995.3-3208s21c1
Sequence:CCGGATGTCTGCACACACCAGAAATCTCGAGATTTCTGGTGTGTGCAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-1844s21c1
Sequence:CCGGTGGACTGGATGTTTCGTTATTCTCGAGAATAACGAAACATCCAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2651s21c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-389s21c1
Sequence:CCGGCGGCTAAGAATGACCATTATCCTCGAGGATAATGGTCATTCTTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003995.3-2791s21c1
Sequence:GTACCGGGCTCGTATGGCCCTAGCATTACTCGAGTAATGCTAGGGCCATACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003995.3-3297s21c1
Sequence:GTACCGGGCAGCTCAGCCCTGTACATATCTCGAGATATGTACAGGGCTGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-2965s1c1
Sequence:CCGGCGAATGGAGTCTAATGGTCAACTCGAGTTGACCATTAGACTCCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-2494s1c1
Sequence:CCGGGCTCTGCTCTACCAAATCCTACTCGAGTAGGATTTGGTAGAGCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-1894s1c1
Sequence:CCGGGCCTTTCTCCACAACAGCATTCTCGAGAATGCTGTTGTGGAGAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003995.x-2651s1c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003995.x-1801s1c1
Sequence:CCGGCGTGGGAGTTTACAGGATATTCTCGAGAATATCCTGTAAACTCCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003995.3-2222s1c1
Sequence:CCGGGAAATGGTCAGCGGCCATATTCTCGAGAATATGGCCGCTGACCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003995.3-2329s1c1
Sequence:CCGGCCAGACTTTGGACAGATTAAGCTCGAGCTTAATCTGTCCAAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003995.3-3158s1c1
Sequence:CCGGCCAAGTCAGATAGTCTTCTGCCTCGAGGCAGAAGACTATCTGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173788
VALIDATED
NPR2 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-3209s21c1
Sequence:CCGGGCTTCTCGAATGGAGTCGAATCTCGAGATTCGACTCCATTCGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-638s21c1
Sequence:CCGGGCAGCTAAGAATGAGCATTATCTCGAGATAATGCTCATTCTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173788.3-3420s21c1
Sequence:CCGGCTGGTACTTGGATGGGCAATGCTCGAGCATTGCCCATCCAAGTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-2473s21c1
Sequence:CCGGGAATGGTCAGAGGCCGTATTTCTCGAGAAATACGGCCTCTGACCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-1893s21c1
Sequence:CCGGTTGCCATCAAACACGTGAATACTCGAGTATTCACGTGTTTGATGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2744s1c1
Sequence:CCGGGCCCTGCTGTACCAAATTCTACTCGAGTAGAATTTGGTACAGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-1229s1c1
Sequence:CCGGCCATCCCTGATGAACCTTATTCTCGAGAATAAGGTTCATCAGGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-3209s1c1
Sequence:CCGGGCTTCTCGAATGGAGTCGAATCTCGAGATTCGACTCCATTCGAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-638s1c1
Sequence:CCGGGCAGCTAAGAATGAGCATTATCTCGAGATAATGCTCATTCTTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2381s1c1
Sequence:CCGGGCCATCATTCTACAGGAAATACTCGAGTATTTCCTGTAGAATGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173788.2-1840s1c1
Sequence:CCGGCCATGGGAAATACCAGATCTTCTCGAGAAGATCTGGTATTTCCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2160s1c1
Sequence:CCGGGCATTATTTCATCTCATGGAACTCGAGTTCCATGAGATGAAATAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2930s1c1
Sequence:CCGGGATGCCATTATCGACAACTTTCTCGAGAAAGTTGTCGATAATGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-344s1c1
Sequence:CCGGCCAGAACACAACCTGAGCTATCTCGAGATAGCTCAGGTTGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2890s1c1
Sequence:CCGGGCAGGTGGTGACACTTCTTAACTCGAGTTAAGAAGTGTCACCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173788
VALIDATED
NPR2 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-3209s21c1
Sequence:CCGGGCTTCTCGAATGGAGTCGAATCTCGAGATTCGACTCCATTCGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-638s21c1
Sequence:CCGGGCAGCTAAGAATGAGCATTATCTCGAGATAATGCTCATTCTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173788.3-3420s21c1
Sequence:CCGGCTGGTACTTGGATGGGCAATGCTCGAGCATTGCCCATCCAAGTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-2473s21c1
Sequence:CCGGGAATGGTCAGAGGCCGTATTTCTCGAGAAATACGGCCTCTGACCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-1893s21c1
Sequence:CCGGTTGCCATCAAACACGTGAATACTCGAGTATTCACGTGTTTGATGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2744s1c1
Sequence:CCGGGCCCTGCTGTACCAAATTCTACTCGAGTAGAATTTGGTACAGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-1229s1c1
Sequence:CCGGCCATCCCTGATGAACCTTATTCTCGAGAATAAGGTTCATCAGGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-3209s1c1
Sequence:CCGGGCTTCTCGAATGGAGTCGAATCTCGAGATTCGACTCCATTCGAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-638s1c1
Sequence:CCGGGCAGCTAAGAATGAGCATTATCTCGAGATAATGCTCATTCTTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2381s1c1
Sequence:CCGGGCCATCATTCTACAGGAAATACTCGAGTATTTCCTGTAGAATGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173788.2-1840s1c1
Sequence:CCGGCCATGGGAAATACCAGATCTTCTCGAGAAGATCTGGTATTTCCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2160s1c1
Sequence:CCGGGCATTATTTCATCTCATGGAACTCGAGTTCCATGAGATGAAATAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2930s1c1
Sequence:CCGGGATGCCATTATCGACAACTTTCTCGAGAAAGTTGTCGATAATGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-344s1c1
Sequence:CCGGCCAGAACACAACCTGAGCTATCTCGAGATAGCTCAGGTTGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2890s1c1
Sequence:CCGGGCAGGTGGTGACACTTCTTAACTCGAGTTAAGAAGTGTCACCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173788
VALIDATED
NPR2 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-3209s21c1
Sequence:CCGGGCTTCTCGAATGGAGTCGAATCTCGAGATTCGACTCCATTCGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-638s21c1
Sequence:CCGGGCAGCTAAGAATGAGCATTATCTCGAGATAATGCTCATTCTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173788.3-3420s21c1
Sequence:CCGGCTGGTACTTGGATGGGCAATGCTCGAGCATTGCCCATCCAAGTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-2473s21c1
Sequence:CCGGGAATGGTCAGAGGCCGTATTTCTCGAGAAATACGGCCTCTGACCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173788.3-1893s21c1
Sequence:CCGGTTGCCATCAAACACGTGAATACTCGAGTATTCACGTGTTTGATGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2744s1c1
Sequence:CCGGGCCCTGCTGTACCAAATTCTACTCGAGTAGAATTTGGTACAGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-1229s1c1
Sequence:CCGGCCATCCCTGATGAACCTTATTCTCGAGAATAAGGTTCATCAGGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-3209s1c1
Sequence:CCGGGCTTCTCGAATGGAGTCGAATCTCGAGATTCGACTCCATTCGAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-638s1c1
Sequence:CCGGGCAGCTAAGAATGAGCATTATCTCGAGATAATGCTCATTCTTAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2381s1c1
Sequence:CCGGGCCATCATTCTACAGGAAATACTCGAGTATTTCCTGTAGAATGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173788.2-1840s1c1
Sequence:CCGGCCATGGGAAATACCAGATCTTCTCGAGAAGATCTGGTATTTCCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2160s1c1
Sequence:CCGGGCATTATTTCATCTCATGGAACTCGAGTTCCATGAGATGAAATAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2930s1c1
Sequence:CCGGGATGCCATTATCGACAACTTTCTCGAGAAAGTTGTCGATAATGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-344s1c1
Sequence:CCGGCCAGAACACAACCTGAGCTATCTCGAGATAGCTCAGGTTGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173788.2-2890s1c1
Sequence:CCGGGCAGGTGGTGACACTTCTTAACTCGAGTTAAGAAGTGTCACCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000907
NPR2 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000000428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-1801s1c1
Sequence:CCGGCGTGGGAGTTTACAGGATATTCTCGAGAATATCCTGTAAACTCCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-2651s1c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-2494s1c1
Sequence:CCGGGCTCTGCTCTACCAAATCCTACTCGAGTAGGATTTGGTAGAGCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000907.x-3036s1c1
Sequence:CCGGCGAATGGAGTCTAATGGTCAACTCGAGTTGACCATTAGACTCCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000907
NPR2 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000000428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-1801s1c1
Sequence:CCGGCGTGGGAGTTTACAGGATATTCTCGAGAATATCCTGTAAACTCCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-2651s1c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-2494s1c1
Sequence:CCGGGCTCTGCTCTACCAAATCCTACTCGAGTAGGATTTGGTAGAGCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000907.x-3036s1c1
Sequence:CCGGCGAATGGAGTCTAATGGTCAACTCGAGTTGACCATTAGACTCCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000907
NPR2 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000000428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-1801s1c1
Sequence:CCGGCGTGGGAGTTTACAGGATATTCTCGAGAATATCCTGTAAACTCCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-2651s1c1
Sequence:CCGGCACTTCTTAATGACCTGTATACTCGAGTATACAGGTCATTAAGAAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000907.x-2494s1c1
Sequence:CCGGGCTCTGCTCTACCAAATCCTACTCGAGTAGGATTTGGTAGAGCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000907.x-3036s1c1
Sequence:CCGGCGAATGGAGTCTAATGGTCAACTCGAGTTGACCATTAGACTCCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)