EMAIL THIS PAGE TO A FRIEND

NPR3

natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)

71 Gene Product Result for
Synonyms: ANP-C ANPR-C ANPRC C5orf23 GUCY2B NPR-C NPRC
UniProtKB ID: P17342, A2RRD1, B4DT84, E7EPG9
Gene ID:
Human(4883) Summary: This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
Mouse(18162) natriuretic peptide receptor 3
Rat(25339) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
domestic guinea pig(100724299) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
naked mole-rat(101722422) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Domestic Rabbit(100354361) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
sheep(101114557) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
fruit fly(249987) non-pupariating 3
cow(281358) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
domestic cat(101082630) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
dog(612616) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
chicken(431663) natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Zebrafish(569395) natriuretic peptide receptor 3
Thale Cress(834545) NPR1-like protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000908 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037441 MISSION® esiRNA esiRNA human NPR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000908 Rosetta Predictions human pricing
NM_012868 Rosetta Predictions rat pricing
NM_001039181 Rosetta Predictions mouse pricing
NM_008728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014143 predicted 1062
2 SASI_Hs01_00014144 predicted 989
3 SASI_Hs01_00014145 predicted 1463
4 SASI_Hs01_00014146 predicted 1133
5 SASI_Hs02_00303476 predicted 1188
6 SASI_Hs01_00014147 predicted 1596
7 SASI_Hs01_00014148 predicted 1014
8 SASI_Hs01_00014149 predicted 1390
9 SASI_Hs01_00014150 predicted 1496
10 SASI_Hs01_00014152 predicted 758
11 SASI_Hs01_00014151 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055729 predicted 841
2 SASI_Rn02_00260355 predicted 1476
3 SASI_Rn01_00055730 predicted 1369
4 SASI_Rn01_00055731 predicted 1290
5 SASI_Rn01_00055732 predicted 863
6 SASI_Rn01_00055733 predicted 938
7 SASI_Rn02_00260356 predicted 621
8 SASI_Rn01_00055735 predicted 545
9 SASI_Rn01_00055736 predicted 924
10 SASI_Rn02_00260357 predicted 1380
11 SASI_Rn01_00055734 predicted 1422
12 SASI_Rn01_00055737 predicted 708
13 SASI_Rn01_00055738 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036567 predicted 857
2 SASI_Mm01_00036568 predicted 1069
3 SASI_Mm02_00289927 predicted 946
4 SASI_Mm01_00036569 predicted 1656
5 SASI_Mm01_00036570 predicted 573
6 SASI_Mm02_00289928 predicted 928
7 SASI_Mm01_00036571 predicted 957
8 SASI_Mm01_00036572 predicted 1670
9 SASI_Mm01_00036574 predicted 1714
10 SASI_Mm01_00036575 predicted 1116
11 SASI_Mm01_00036573 predicted 1191
12 SASI_Mm01_00036576 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111063 predicted 861
2 SASI_Mm01_00111064 predicted 1067
3 SASI_Mm02_00314581 predicted 938
4 SASI_Mm01_00111065 predicted 1664
5 SASI_Mm01_00111066 predicted 573
6 SASI_Mm02_00314582 predicted 930
7 SASI_Mm01_00111067 predicted 960
8 SASI_Mm01_00111068 predicted 1666
9 SASI_Mm01_00111070 predicted 1714
10 SASI_Mm01_00111071 predicted 1120
11 SASI_Mm01_00111069 predicted 1194
12 SASI_Mm01_00111072 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008728
VALIDATED
NPR3 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-912s1c1
Sequence:CCGGCTCTGAAGCTAAACAAGCATACTCGAGTATGCTTGTTTAGCTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1081s1c1
Sequence:CCGGCTCCTCTACGTTCTGGCTTTACTCGAGTAAAGCCAGAACGTAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-588s1c1
Sequence:CCGGCCTGGTCTACAGCGACGACAACTCGAGTTGTCGTCGCTGTAGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-825s1c1
Sequence:CCGGCAGTGGAGACTACGCTTTCTTCTCGAGAAGAAAGCGTAGTCTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1278s1c1
Sequence:CCGGCATTGGTGATTACTTTGGGAACTCGAGTTCCCAAAGTAATCACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1345s1c1
Sequence:CCGGCCTTTGAAACTGAGACTAGATCTCGAGATCTAGTCTCAGTTTCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-1306s1c1
Sequence:CCGGCGGTTCCAAATGCGATCGAATCTCGAGATTCGATCGCATTTGGAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-1155s1c1
Sequence:CCGGGCAGACTTGGAACAGGACATTCTCGAGAATGTCCTGTTCCAAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-672s1c1
Sequence:CCGGGCACACGTCTGCCTACAATTTCTCGAGAAATTGTAGGCAGACGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-165s1c1
Sequence:CCGGCCGGGACATTACGTACTTGTTCTCGAGAACAAGTACGTAATGTCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008728
VALIDATED
NPR3 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-912s1c1
Sequence:CCGGCTCTGAAGCTAAACAAGCATACTCGAGTATGCTTGTTTAGCTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1081s1c1
Sequence:CCGGCTCCTCTACGTTCTGGCTTTACTCGAGTAAAGCCAGAACGTAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-588s1c1
Sequence:CCGGCCTGGTCTACAGCGACGACAACTCGAGTTGTCGTCGCTGTAGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-825s1c1
Sequence:CCGGCAGTGGAGACTACGCTTTCTTCTCGAGAAGAAAGCGTAGTCTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1278s1c1
Sequence:CCGGCATTGGTGATTACTTTGGGAACTCGAGTTCCCAAAGTAATCACCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1345s1c1
Sequence:CCGGCCTTTGAAACTGAGACTAGATCTCGAGATCTAGTCTCAGTTTCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-1306s1c1
Sequence:CCGGCGGTTCCAAATGCGATCGAATCTCGAGATTCGATCGCATTTGGAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-1155s1c1
Sequence:CCGGGCAGACTTGGAACAGGACATTCTCGAGAATGTCCTGTTCCAAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-672s1c1
Sequence:CCGGGCACACGTCTGCCTACAATTTCTCGAGAAATTGTAGGCAGACGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-165s1c1
Sequence:CCGGCCGGGACATTACGTACTTGTTCTCGAGAACAAGTACGTAATGTCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008728
VALIDATED
NPR3 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-912s1c1
Sequence:CCGGCTCTGAAGCTAAACAAGCATACTCGAGTATGCTTGTTTAGCTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1081s1c1
Sequence:CCGGCTCCTCTACGTTCTGGCTTTACTCGAGTAAAGCCAGAACGTAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-588s1c1
Sequence:CCGGCCTGGTCTACAGCGACGACAACTCGAGTTGTCGTCGCTGTAGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-825s1c1
Sequence:CCGGCAGTGGAGACTACGCTTTCTTCTCGAGAAGAAAGCGTAGTCTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1278s1c1
Sequence:CCGGCATTGGTGATTACTTTGGGAACTCGAGTTCCCAAAGTAATCACCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-1345s1c1
Sequence:CCGGCCTTTGAAACTGAGACTAGATCTCGAGATCTAGTCTCAGTTTCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-1306s1c1
Sequence:CCGGCGGTTCCAAATGCGATCGAATCTCGAGATTCGATCGCATTTGGAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-1155s1c1
Sequence:CCGGGCAGACTTGGAACAGGACATTCTCGAGAATGTCCTGTTCCAAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008728.1-672s1c1
Sequence:CCGGGCACACGTCTGCCTACAATTTCTCGAGAAATTGTAGGCAGACGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008728.1-165s1c1
Sequence:CCGGCCGGGACATTACGTACTTGTTCTCGAGAACAAGTACGTAATGTCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000908
NPR3 MISSION shRNA Bacterial Glycerol Stock
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000908.2-1870s1c1
Sequence:CCGGCCTGAGATTCTTTAAGGAGATCTCGAGATCTCCTTAAAGAATCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-1604s1c1
Sequence:CCGGCCGAATTGTAGAGCATACAAACTCGAGTTTGTATGCTCTACAATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-905s1c1
Sequence:CCGGGCACACGTCCATCTACAGTTTCTCGAGAAACTGTAGATGGACGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-398s1c1
Sequence:CCGGCCAGGATGACTCGTACTTGTTCTCGAGAACAAGTACGAGTCATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-1502s1c1
Sequence:CCGGCCAGGAGGTTATTGGTGATTACTCGAGTAATCACCAATAACCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000908.2-2058s21c1
Sequence:CCGGTATCGTGTCACTCTGTTAAATCTCGAGATTTAACAGAGTGACACGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1504s21c1
Sequence:CCGGAGGAGGTTATTGGTGATTATTCTCGAGAATAATCACCAATAACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1262s21c1
Sequence:CCGGCAATATGGAGGATTACGTTAACTCGAGTTAACGTAATCCTCCATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1437s21c1
Sequence:CCGGGATGCCAACGGAGACCGATATCTCGAGATATCGGTCTCCGTTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000908
NPR3 MISSION shRNA shRNA Plasmid DNA
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000908.2-1870s1c1
Sequence:CCGGCCTGAGATTCTTTAAGGAGATCTCGAGATCTCCTTAAAGAATCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-1604s1c1
Sequence:CCGGCCGAATTGTAGAGCATACAAACTCGAGTTTGTATGCTCTACAATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-905s1c1
Sequence:CCGGGCACACGTCCATCTACAGTTTCTCGAGAAACTGTAGATGGACGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-398s1c1
Sequence:CCGGCCAGGATGACTCGTACTTGTTCTCGAGAACAAGTACGAGTCATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-1502s1c1
Sequence:CCGGCCAGGAGGTTATTGGTGATTACTCGAGTAATCACCAATAACCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000908.2-2058s21c1
Sequence:CCGGTATCGTGTCACTCTGTTAAATCTCGAGATTTAACAGAGTGACACGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1504s21c1
Sequence:CCGGAGGAGGTTATTGGTGATTATTCTCGAGAATAATCACCAATAACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1262s21c1
Sequence:CCGGCAATATGGAGGATTACGTTAACTCGAGTTAACGTAATCCTCCATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1437s21c1
Sequence:CCGGGATGCCAACGGAGACCGATATCTCGAGATATCGGTCTCCGTTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000908
NPR3 MISSION shRNA Lentiviral Transduction Particles
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000908.2-1870s1c1
Sequence:CCGGCCTGAGATTCTTTAAGGAGATCTCGAGATCTCCTTAAAGAATCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-1604s1c1
Sequence:CCGGCCGAATTGTAGAGCATACAAACTCGAGTTTGTATGCTCTACAATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-905s1c1
Sequence:CCGGGCACACGTCCATCTACAGTTTCTCGAGAAACTGTAGATGGACGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-398s1c1
Sequence:CCGGCCAGGATGACTCGTACTTGTTCTCGAGAACAAGTACGAGTCATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000908.2-1502s1c1
Sequence:CCGGCCAGGAGGTTATTGGTGATTACTCGAGTAATCACCAATAACCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000908.2-2058s21c1
Sequence:CCGGTATCGTGTCACTCTGTTAAATCTCGAGATTTAACAGAGTGACACGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1504s21c1
Sequence:CCGGAGGAGGTTATTGGTGATTATTCTCGAGAATAATCACCAATAACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1262s21c1
Sequence:CCGGCAATATGGAGGATTACGTTAACTCGAGTTAACGTAATCCTCCATATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000908.2-1437s21c1
Sequence:CCGGGATGCCAACGGAGACCGATATCTCGAGATATCGGTCTCCGTTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)