EMAIL THIS PAGE TO A FRIEND

NPRL2

nitrogen permease regulator-like 2 (S. cerevisiae)

86 Gene Product Result for
Synonyms: NPR2 NPR2L TUSC4
UniProtKB ID: Q8WTW4, A8K831, Q6FGS2, Q9Y249, Q9Y497
Gene ID:
Mouse(56032) nitrogen permease regulator-like 2
Rat(363138) nitrogen permease regulator-like 2 (S. cerevisiae)
Zebrafish(559391) nitrogen permease regulator-like 2 (S. cerevisiae)
cow(508487) nitrogen permease regulator-like 2 (S. cerevisiae)
domestic cat(101095158) nitrogen permease regulator-like 2 (S. cerevisiae)
dog(476614) nitrogen permease regulator-like 2 (S. cerevisiae)
chicken(425132) nitrogen permease regulator-like 2 (S. cerevisiae)
sheep(101120700) nitrogen permease regulator-like 2 (S. cerevisiae)
naked mole-rat(101705186) nitrogen permease regulator-like 2 (S. cerevisiae)
domestic guinea pig(100718057) nitrogen permease regulator-like 2 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038196 Anti-NPRL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA038197 Anti-NPRL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305758 ANTI-NPRL2(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
T4578 Anti-TUSC4 (156-170) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1400399 Anti-TUSC4 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1400400 Anti-TUSC4 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2105172 Anti-TUSC4 antibody produced in rabbit affinity isolated antibody bovine, rabbit, human, rat, guinea pig, mouse
western blot pricing
SAB2103605 Anti-TUSC4, (N-terminal) antibody produced in rabbit affinity isolated antibody human, dog, bovine, rat, mouse, rabbit, guinea pig
immunohistochemistry, western blot pricing
SAB2501073 Anti-TUSC4/NPRL2 (AA 140-151) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB2501074 Anti-TUSC4/NPRL2 (AA 269-280) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006545 Rosetta Predictions human pricing
NM_001025744 Rosetta Predictions rat pricing
NM_018879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200293 predicted 975
2 SASI_Hs01_00200294 predicted 1079
3 SASI_Hs01_00200295 predicted 914
4 SASI_Hs01_00200296 predicted 557
5 SASI_Hs01_00200297 predicted 560
6 SASI_Hs01_00200298 predicted 471
7 SASI_Hs01_00200299 predicted 610
8 SASI_Hs01_00200300 predicted 1344
9 SASI_Hs01_00200301 predicted 1031
10 SASI_Hs01_00200302 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203386 predicted 858
2 SASI_Rn02_00203387 predicted 809
3 SASI_Rn02_00203388 predicted 1035
4 SASI_Rn01_00050258 predicted 271
5 SASI_Rn02_00203389 predicted 738
6 SASI_Rn01_00050262 predicted 234
7 SASI_Rn02_00203390 predicted 1099
8 SASI_Rn02_00203391 predicted 1317
9 SASI_Rn02_00203392 predicted 454
10 SASI_Rn02_00203393 predicted 922
11 SASI_Rn01_00050256 predicted 903
12 SASI_Rn01_00050257 predicted 571
13 SASI_Rn01_00050259 predicted 776
14 SASI_Rn01_00050260 predicted 656
15 SASI_Rn01_00050261 predicted 254
16 SASI_Rn01_00050263 predicted 758
17 SASI_Rn01_00050264 predicted 843
18 SASI_Rn01_00050265 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082262 predicted 825
2 SASI_Mm01_00082263 predicted 848
3 SASI_Mm02_00324284 predicted 1127
4 SASI_Mm01_00082264 predicted 894
5 SASI_Mm01_00082265 predicted 997
6 SASI_Mm01_00082266 predicted 1189
7 SASI_Mm01_00082267 predicted 1074
8 SASI_Mm01_00082268 predicted 379
9 SASI_Mm01_00082269 predicted 1130
10 SASI_Mm01_00082270 predicted 1085
11 SASI_Mm01_00082271 predicted 1080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018879
VALIDATED
NPRL2 MISSION shRNA Bacterial Glycerol Stock
nitrogen permease regulator-like 2 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-1207s1c1
Sequence:CCGGCTGTCACAGCTATGATGAGATCTCGAGATCTCATCATAGCTGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-880s1c1
Sequence:CCGGCCTCCAGTACTCCAATGTGTACTCGAGTACACATTGGAGTACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-383s1c1
Sequence:CCGGCACAAGAAGTACAGCCGCAATCTCGAGATTGCGGCTGTACTTCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-968s1c1
Sequence:CCGGGTCACCAAGCAAGGACACAAACTCGAGTTTGTGTCCTTGCTTGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-1076s1c1
Sequence:CCGGCAGTTACAACACGTTGATGAACTCGAGTTCATCAACGTGTTGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-677s1c1
Sequence:CCGGGAGTATGATGTGCCCGTCTTTCTCGAGAAAGACGGGCACATCATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-370s1c1
Sequence:CCGGCGTGTGCATTGAACACAAGAACTCGAGTTCTTGTGTTCAATGCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-1000s1c1
Sequence:CCGGCCGAGATGTGTTCCAGCTATACTCGAGTATAGCTGGAACACATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-508s1c1
Sequence:CCGGTGAGAGCAGCTTTGTATCCAACTCGAGTTGGATACAAAGCTGCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-616s1c1
Sequence:CCGGCGAATCCAACACCATCCACTTCTCGAGAAGTGGATGGTGTTGGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018879
VALIDATED
NPRL2 MISSION shRNA shRNA Plasmid DNA
nitrogen permease regulator-like 2 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-1207s1c1
Sequence:CCGGCTGTCACAGCTATGATGAGATCTCGAGATCTCATCATAGCTGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-880s1c1
Sequence:CCGGCCTCCAGTACTCCAATGTGTACTCGAGTACACATTGGAGTACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-383s1c1
Sequence:CCGGCACAAGAAGTACAGCCGCAATCTCGAGATTGCGGCTGTACTTCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-968s1c1
Sequence:CCGGGTCACCAAGCAAGGACACAAACTCGAGTTTGTGTCCTTGCTTGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-1076s1c1
Sequence:CCGGCAGTTACAACACGTTGATGAACTCGAGTTCATCAACGTGTTGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-677s1c1
Sequence:CCGGGAGTATGATGTGCCCGTCTTTCTCGAGAAAGACGGGCACATCATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-370s1c1
Sequence:CCGGCGTGTGCATTGAACACAAGAACTCGAGTTCTTGTGTTCAATGCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-1000s1c1
Sequence:CCGGCCGAGATGTGTTCCAGCTATACTCGAGTATAGCTGGAACACATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-508s1c1
Sequence:CCGGTGAGAGCAGCTTTGTATCCAACTCGAGTTGGATACAAAGCTGCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-616s1c1
Sequence:CCGGCGAATCCAACACCATCCACTTCTCGAGAAGTGGATGGTGTTGGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018879
VALIDATED
NPRL2 MISSION shRNA Lentiviral Transduction Particles
nitrogen permease regulator-like 2 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-1207s1c1
Sequence:CCGGCTGTCACAGCTATGATGAGATCTCGAGATCTCATCATAGCTGTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-880s1c1
Sequence:CCGGCCTCCAGTACTCCAATGTGTACTCGAGTACACATTGGAGTACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-383s1c1
Sequence:CCGGCACAAGAAGTACAGCCGCAATCTCGAGATTGCGGCTGTACTTCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-968s1c1
Sequence:CCGGGTCACCAAGCAAGGACACAAACTCGAGTTTGTGTCCTTGCTTGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-1076s1c1
Sequence:CCGGCAGTTACAACACGTTGATGAACTCGAGTTCATCAACGTGTTGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-677s1c1
Sequence:CCGGGAGTATGATGTGCCCGTCTTTCTCGAGAAAGACGGGCACATCATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-370s1c1
Sequence:CCGGCGTGTGCATTGAACACAAGAACTCGAGTTCTTGTGTTCAATGCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-1000s1c1
Sequence:CCGGCCGAGATGTGTTCCAGCTATACTCGAGTATAGCTGGAACACATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018879.1-508s1c1
Sequence:CCGGTGAGAGCAGCTTTGTATCCAACTCGAGTTGGATACAAAGCTGCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018879.1-616s1c1
Sequence:CCGGCGAATCCAACACCATCCACTTCTCGAGAAGTGGATGGTGTTGGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006545
VALIDATED
NPRL2 MISSION shRNA Bacterial Glycerol Stock
nitrogen permease regulator-like 2 (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-929s1c1
Sequence:CCGGGCAAGAGGCATGTCTATCCTACTCGAGTAGGATAGACATGCCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-660s1c1
Sequence:CCGGGAGTATGATGTACCTGTCTTTCTCGAGAAAGACAGGTACATCATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-308s1c1
Sequence:CCGGGCTTATCACTGTCACAGCTATCTCGAGATAGCTGTGACAGTGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-1064s1c1
Sequence:CCGGGCAGCATGTTGATGAACGGAACTCGAGTTCCGTTCATCAACATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-915s21c1
Sequence:CCGGAGTATGATGTACCTGTCTTTACTCGAGTAAAGACAGGTACATCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-593s1c1
Sequence:CCGGCATTGATGAGTCCAACACCATCTCGAGATGGTGTTGGACTCATCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1117s21c1
Sequence:CCGGCCTCCAGTACTCCAATGTATACTCGAGTATACATTGGAGTACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-803s21c1
Sequence:CCGGATCTTGCTGGAGGAGCTAAATCTCGAGATTTAGCTCCTCCAGCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1180s21c1
Sequence:CCGGCCTGCAAGAGGCATGTCTATCCTCGAGGATAGACATGCCTCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1340s21c1
Sequence:CCGGCTGATCCAGTTCGGGCTTATGCTCGAGCATAAGCCCGAACTGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006545
VALIDATED
NPRL2 MISSION shRNA shRNA Plasmid DNA
nitrogen permease regulator-like 2 (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-929s1c1
Sequence:CCGGGCAAGAGGCATGTCTATCCTACTCGAGTAGGATAGACATGCCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-660s1c1
Sequence:CCGGGAGTATGATGTACCTGTCTTTCTCGAGAAAGACAGGTACATCATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-308s1c1
Sequence:CCGGGCTTATCACTGTCACAGCTATCTCGAGATAGCTGTGACAGTGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-1064s1c1
Sequence:CCGGGCAGCATGTTGATGAACGGAACTCGAGTTCCGTTCATCAACATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-915s21c1
Sequence:CCGGAGTATGATGTACCTGTCTTTACTCGAGTAAAGACAGGTACATCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-593s1c1
Sequence:CCGGCATTGATGAGTCCAACACCATCTCGAGATGGTGTTGGACTCATCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1117s21c1
Sequence:CCGGCCTCCAGTACTCCAATGTATACTCGAGTATACATTGGAGTACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-803s21c1
Sequence:CCGGATCTTGCTGGAGGAGCTAAATCTCGAGATTTAGCTCCTCCAGCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1180s21c1
Sequence:CCGGCCTGCAAGAGGCATGTCTATCCTCGAGGATAGACATGCCTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1340s21c1
Sequence:CCGGCTGATCCAGTTCGGGCTTATGCTCGAGCATAAGCCCGAACTGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006545
VALIDATED
NPRL2 MISSION shRNA Lentiviral Transduction Particles
nitrogen permease regulator-like 2 (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-929s1c1
Sequence:CCGGGCAAGAGGCATGTCTATCCTACTCGAGTAGGATAGACATGCCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-660s1c1
Sequence:CCGGGAGTATGATGTACCTGTCTTTCTCGAGAAAGACAGGTACATCATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-308s1c1
Sequence:CCGGGCTTATCACTGTCACAGCTATCTCGAGATAGCTGTGACAGTGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-1064s1c1
Sequence:CCGGGCAGCATGTTGATGAACGGAACTCGAGTTCCGTTCATCAACATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-915s21c1
Sequence:CCGGAGTATGATGTACCTGTCTTTACTCGAGTAAAGACAGGTACATCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006545.3-593s1c1
Sequence:CCGGCATTGATGAGTCCAACACCATCTCGAGATGGTGTTGGACTCATCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1117s21c1
Sequence:CCGGCCTCCAGTACTCCAATGTATACTCGAGTATACATTGGAGTACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-803s21c1
Sequence:CCGGATCTTGCTGGAGGAGCTAAATCTCGAGATTTAGCTCCTCCAGCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1180s21c1
Sequence:CCGGCCTGCAAGAGGCATGTCTATCCTCGAGGATAGACATGCCTCTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006545.4-1340s21c1
Sequence:CCGGCTGATCCAGTTCGGGCTTATGCTCGAGCATAAGCCCGAACTGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)