EMAIL THIS PAGE TO A FRIEND

NPTN

neuroplastin

96 Gene Product Result for
Synonyms: GP55 GP65 SDFR1 SDR1 np55 np65
Gene ID:
Human(27020) Summary: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2009]
Mouse(20320) neuroplastin
Rat(56064) neuroplastin
chicken(415316) neuroplastin
cow(540039) neuroplastin
Horse(100052106) neuroplastin
dog(487637) neuroplastin
sheep(101110943) neuroplastin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46899 Anti-NPTN antibody produced in rabbit IgG fraction of antiserum horse, guinea pig, human, rat, canine, mouse, bovine, rabbit
immunohistochemistry, western blot pricing
SAB2101625 Anti-NPTN antibody produced in rabbit affinity isolated antibody human, zebrafish, guinea pig, rabbit, rat, bovine, horse, mouse
western blot pricing
HPA051497 Anti-NPTN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501182 Anti-NPTN antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
HPA072453 Anti-NPTN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012428 Rosetta Predictions human pricing
NM_017455 Rosetta Predictions human pricing
NM_019380 Rosetta Predictions rat pricing
NM_009145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344311 predicted 1231
2 SASI_Hs02_00344312 predicted 1312
3 SASI_Hs02_00344313 predicted 1331
4 SASI_Hs01_00213574 predicted 961
5 SASI_Hs02_00344314 predicted 918
6 SASI_Hs02_00344315 predicted 1254
7 SASI_Hs01_00213576 predicted 945
8 SASI_Hs02_00344316 predicted 1341
9 SASI_Hs02_00344317 predicted 1153
10 SASI_Hs02_00344318 predicted 1235
11 SASI_Hs01_00213573 predicted 994
12 SASI_Hs01_00213575 predicted 834
13 SASI_Hs01_00213577 predicted 871
14 SASI_Hs01_00213578 predicted 1135
15 SASI_Hs01_00213579 predicted 1390
16 SASI_Hs01_00213580 predicted 959
17 SASI_Hs01_00213581 predicted 995
18 SASI_Hs01_00213582 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350071 predicted 882
2 SASI_Hs02_00350072 predicted 962
3 SASI_Hs02_00350073 predicted 982
4 SASI_Hs01_00165717 predicted 612
5 SASI_Hs02_00350074 predicted 565
6 SASI_Hs02_00350075 predicted 905
7 SASI_Hs01_00165719 predicted 599
8 SASI_Hs02_00350076 predicted 995
9 SASI_Hs02_00350077 predicted 804
10 SASI_Hs02_00350078 predicted 889
11 SASI_Hs01_00165716 predicted 654
12 SASI_Hs01_00165718 predicted 485
13 SASI_Hs01_00165720 predicted 523
14 SASI_Hs01_00165721 predicted 781
15 SASI_Hs01_00165722 predicted 1042
16 SASI_Hs01_00165723 predicted 615
17 SASI_Hs01_00165724 predicted 647
18 SASI_Hs01_00165725 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093949 predicted 889
2 SASI_Rn01_00093950 predicted 937
3 SASI_Rn01_00093951 predicted 1308
4 SASI_Rn01_00093952 predicted 1276
5 SASI_Rn01_00093953 predicted 671
6 SASI_Rn01_00093954 predicted 1161
7 SASI_Rn01_00093955 predicted 1012
8 SASI_Rn01_00093956 predicted 730
9 SASI_Rn01_00093957 predicted 779
10 SASI_Rn01_00093958 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159781 predicted 479
2 SASI_Mm01_00159782 predicted 595
3 SASI_Mm01_00159783 predicted 650
4 SASI_Mm01_00159784 predicted 1030
5 SASI_Mm01_00159785 predicted 878
6 SASI_Mm01_00159786 predicted 871
7 SASI_Mm01_00159787 predicted 523
8 SASI_Mm02_00315457 predicted 764
9 SASI_Mm01_00159788 predicted 773
10 SASI_Mm02_00315458 predicted 889
11 SASI_Mm01_00159789 predicted 554
12 SASI_Mm01_00159790 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009145
VALIDATED
NPTN MISSION shRNA Bacterial Glycerol Stock
neuroplastin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-615s1c1
Sequence:CCGGGTATGAATGTAATGCCACCAACTCGAGTTGGTGGCATTACATTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-121s1c1
Sequence:CCGGCCAAGAATTGTCACCAGTGAACTCGAGTTCACTGGTGACAATTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-276s1c2
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-1624s21c1
Sequence:CCGGTCTAAGGGCTTACCGTATAACCTCGAGGTTATACGGTAAGCCCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-897s21c1
Sequence:CCGGTCATCCTTGTGGTGATCATTGCTCGAGCAATGATCACCACAAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-445s21c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-732s21c1
Sequence:CCGGATTACACTGAATTGAGTATTGCTCGAGCAATACTCAATTCAGTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-301s21c1
Sequence:CCGGCACCAGTGAAGAGGTCATTATCTCGAGATAATGACCTCTTCACTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009145
VALIDATED
NPTN MISSION shRNA shRNA Plasmid DNA
neuroplastin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-615s1c1
Sequence:CCGGGTATGAATGTAATGCCACCAACTCGAGTTGGTGGCATTACATTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-121s1c1
Sequence:CCGGCCAAGAATTGTCACCAGTGAACTCGAGTTCACTGGTGACAATTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-276s1c2
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-1624s21c1
Sequence:CCGGTCTAAGGGCTTACCGTATAACCTCGAGGTTATACGGTAAGCCCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-897s21c1
Sequence:CCGGTCATCCTTGTGGTGATCATTGCTCGAGCAATGATCACCACAAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-445s21c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-732s21c1
Sequence:CCGGATTACACTGAATTGAGTATTGCTCGAGCAATACTCAATTCAGTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-301s21c1
Sequence:CCGGCACCAGTGAAGAGGTCATTATCTCGAGATAATGACCTCTTCACTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009145
VALIDATED
NPTN MISSION shRNA Lentiviral Transduction Particles
neuroplastin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-615s1c1
Sequence:CCGGGTATGAATGTAATGCCACCAACTCGAGTTGGTGGCATTACATTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-121s1c1
Sequence:CCGGCCAAGAATTGTCACCAGTGAACTCGAGTTCACTGGTGACAATTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009145.1-276s1c2
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-1624s21c1
Sequence:CCGGTCTAAGGGCTTACCGTATAACCTCGAGGTTATACGGTAAGCCCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-897s21c1
Sequence:CCGGTCATCCTTGTGGTGATCATTGCTCGAGCAATGATCACCACAAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-445s21c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-732s21c1
Sequence:CCGGATTACACTGAATTGAGTATTGCTCGAGCAATACTCAATTCAGTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009145.2-301s21c1
Sequence:CCGGCACCAGTGAAGAGGTCATTATCTCGAGATAATGACCTCTTCACTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012428
VALIDATED
NPTN MISSION shRNA Bacterial Glycerol Stock
neuroplastin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012428.1-1069s1c1
Sequence:CCGGCCTGGCGAGTATGAATGTAATCTCGAGATTACATTCATACTCGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-1286s1c1
Sequence:CCGGCTACCAACAATCACAAAGATACTCGAGTATCTTTGTGATTGTTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-428s1c1
Sequence:CCGGGCGTGAGTGTGCTGAGAATAACTCGAGTTATTCTCAGCACACTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012428.1-738s1c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-243s1c1
Sequence:CCGGGTCGCCCATGTCAGAAACTAACTCGAGTTAGTTTCTGACATGGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-651s21c1
Sequence:CCGGACCAGTGAAGAGGTCATTATTCTCGAGAATAATGACCTCTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-838s21c1
Sequence:CCGGGCGAATACCACTGCGTATATCCTCGAGGATATACGCAGTGGTATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-797s21c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012428.2-1128s21c1
Sequence:CCGGCCTGGCGAGTATGAATGTAATCTCGAGATTACATTCATACTCGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-650s21c1
Sequence:CCGGCACCAGTGAAGAGGTCATTATCTCGAGATAATGACCTCTTCACTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-1547s21c1
Sequence:CCGGGTGATCTAGCCAGGTACATTTCTCGAGAAATGTACCTGGCTAGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-1510s21c1
Sequence:CCGGTGTCTAAAGCATGCCTTATTTCTCGAGAAATAAGGCATGCTTTAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-836s21c1
Sequence:CCGGAGGCGAATACCACTGCGTATACTCGAGTATACGCAGTGGTATTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-837s21c1
Sequence:CCGGGGCGAATACCACTGCGTATATCTCGAGATATACGCAGTGGTATTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012428
VALIDATED
NPTN MISSION shRNA shRNA Plasmid DNA
neuroplastin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012428.1-1069s1c1
Sequence:CCGGCCTGGCGAGTATGAATGTAATCTCGAGATTACATTCATACTCGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-1286s1c1
Sequence:CCGGCTACCAACAATCACAAAGATACTCGAGTATCTTTGTGATTGTTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-428s1c1
Sequence:CCGGGCGTGAGTGTGCTGAGAATAACTCGAGTTATTCTCAGCACACTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012428.1-738s1c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-243s1c1
Sequence:CCGGGTCGCCCATGTCAGAAACTAACTCGAGTTAGTTTCTGACATGGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-651s21c1
Sequence:CCGGACCAGTGAAGAGGTCATTATTCTCGAGAATAATGACCTCTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-838s21c1
Sequence:CCGGGCGAATACCACTGCGTATATCCTCGAGGATATACGCAGTGGTATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-797s21c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012428.2-1128s21c1
Sequence:CCGGCCTGGCGAGTATGAATGTAATCTCGAGATTACATTCATACTCGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-650s21c1
Sequence:CCGGCACCAGTGAAGAGGTCATTATCTCGAGATAATGACCTCTTCACTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-1547s21c1
Sequence:CCGGGTGATCTAGCCAGGTACATTTCTCGAGAAATGTACCTGGCTAGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-1510s21c1
Sequence:CCGGTGTCTAAAGCATGCCTTATTTCTCGAGAAATAAGGCATGCTTTAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-836s21c1
Sequence:CCGGAGGCGAATACCACTGCGTATACTCGAGTATACGCAGTGGTATTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-837s21c1
Sequence:CCGGGGCGAATACCACTGCGTATATCTCGAGATATACGCAGTGGTATTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012428
VALIDATED
NPTN MISSION shRNA Lentiviral Transduction Particles
neuroplastin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012428.1-1069s1c1
Sequence:CCGGCCTGGCGAGTATGAATGTAATCTCGAGATTACATTCATACTCGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-1286s1c1
Sequence:CCGGCTACCAACAATCACAAAGATACTCGAGTATCTTTGTGATTGTTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-428s1c1
Sequence:CCGGGCGTGAGTGTGCTGAGAATAACTCGAGTTATTCTCAGCACACTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012428.1-738s1c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012428.1-243s1c1
Sequence:CCGGGTCGCCCATGTCAGAAACTAACTCGAGTTAGTTTCTGACATGGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-651s21c1
Sequence:CCGGACCAGTGAAGAGGTCATTATTCTCGAGAATAATGACCTCTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-838s21c1
Sequence:CCGGGCGAATACCACTGCGTATATCCTCGAGGATATACGCAGTGGTATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-797s21c1
Sequence:CCGGCATGGAGTACAGGATCAATAACTCGAGTTATTGATCCTGTACTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012428.2-1128s21c1
Sequence:CCGGCCTGGCGAGTATGAATGTAATCTCGAGATTACATTCATACTCGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-650s21c1
Sequence:CCGGCACCAGTGAAGAGGTCATTATCTCGAGATAATGACCTCTTCACTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-1547s21c1
Sequence:CCGGGTGATCTAGCCAGGTACATTTCTCGAGAAATGTACCTGGCTAGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-1510s21c1
Sequence:CCGGTGTCTAAAGCATGCCTTATTTCTCGAGAAATAAGGCATGCTTTAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.3-836s21c1
Sequence:CCGGAGGCGAATACCACTGCGTATACTCGAGTATACGCAGTGGTATTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012428.2-837s21c1
Sequence:CCGGGGCGAATACCACTGCGTATATCTCGAGATATACGCAGTGGTATTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)