EMAIL THIS PAGE TO A FRIEND

NPTX1

neuronal pentraxin I

214 Gene Product Result for
Synonyms: NP1
UniProtKB ID: Q15818, B3KXH3, Q5FWE6
Gene ID:
Human(4884) Summary: NPTX1 is a member of the neuronal pentraxin gene family. Neuronal pentraxin 1 is similar to the rat NP1 gene which encodes a binding protein for the snake venom toxin taipoxin. Human NPTX1 mRNA is exclusively localized to the nervous system. [provided by RefSeq, Jul 2008]
Mouse(18164) neuronal pentraxin 1
Rat(266777) neuronal pentraxin I
chicken(422078) neuronal pentraxin I
domestic cat(101095700) neuronal pentraxin I
cow(513538) neuronal pentraxin I
dog(483356) neuronal pentraxin I
domestic guinea pig(100729432) neuronal pentraxin I
naked mole-rat(101723897) neuronal pentraxin I
sheep(101119737) neuronal pentraxin I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002522 Rosetta Predictions human pricing
NM_153735 Rosetta Predictions rat pricing
NM_008730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088184 predicted 1378
2 SASI_Hs02_00333993 predicted 992
3 SASI_Hs01_00088185 predicted 1270
4 SASI_Hs01_00088186 predicted 1492
5 SASI_Hs01_00088187 predicted 828
6 SASI_Hs01_00088189 predicted 839
7 SASI_Hs01_00088190 predicted 863
8 SASI_Hs01_00088191 predicted 1024
9 SASI_Hs01_00088192 predicted 1170
10 SASI_Hs01_00088193 predicted 784
11 SASI_Hs01_00088188 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071628 predicted 605
2 SASI_Rn01_00071629 predicted 1189
3 SASI_Rn01_00071630 predicted 363
4 SASI_Rn01_00071631 predicted 849
5 SASI_Rn01_00071632 predicted 999
6 SASI_Rn01_00071633 predicted 834
7 SASI_Rn01_00071635 predicted 496
8 SASI_Rn01_00071636 predicted 585
9 SASI_Rn01_00071637 predicted 1237
10 SASI_Rn02_00269035 predicted 1277
11 SASI_Rn01_00071634 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025837 predicted 665
2 SASI_Mm01_00025838 predicted 1346
3 SASI_Mm01_00025839 predicted 896
4 SASI_Mm01_00025840 predicted 623
5 SASI_Mm01_00025841 predicted 459
6 SASI_Mm01_00025842 predicted 913
7 SASI_Mm01_00025843 predicted 1060
8 SASI_Mm01_00025844 predicted 709
9 SASI_Mm01_00025845 predicted 1243
10 SASI_Mm01_00025846 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002522
VALIDATED
NPTX1 MISSION shRNA Bacterial Glycerol Stock
neuronal pentraxin I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-901s21c1
Sequence:CCGGCAGAGATGTACGCCTTCACTGCTCGAGCAGTGAAGGCGTACATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-604s21c1
Sequence:CCGGAGTACAGCCGCCTCAATTCCTCTCGAGAGGAATTGAGGCGGCTGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-997s21c1
Sequence:CCGGACGAGCTGGTCCTCATTGAGTCTCGAGACTCAATGAGGACCAGCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002522.3-1896s21c1
Sequence:CCGGTGTTAGCTGCGTGCGTGCTTTCTCGAGAAAGCACGCACGCAGCTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-1003s1c1
Sequence:CCGGCCCATGGAGATCCTCATCAATCTCGAGATTGATGAGGATCTCCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-348s1c1
Sequence:CCGGCCTGAGCCAGAAGGAGACCATCTCGAGATGGTCTCCTTCTGGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-209s1c1
Sequence:CCGGCGACGCGCTTCATCTGCACTTCTCGAGAAGTGCAGATGAAGCGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002522.1-832s1c1
Sequence:CCGGCTGCGGACCAACTATATGTATCTCGAGATACATATAGTTGGTCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-534s1c1
Sequence:CCGGGCAAACTTTGCAATCGCTCAACTCGAGTTGAGCGATTGCAAAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002522
VALIDATED
NPTX1 MISSION shRNA shRNA Plasmid DNA
neuronal pentraxin I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-901s21c1
Sequence:CCGGCAGAGATGTACGCCTTCACTGCTCGAGCAGTGAAGGCGTACATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-604s21c1
Sequence:CCGGAGTACAGCCGCCTCAATTCCTCTCGAGAGGAATTGAGGCGGCTGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-997s21c1
Sequence:CCGGACGAGCTGGTCCTCATTGAGTCTCGAGACTCAATGAGGACCAGCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002522.3-1896s21c1
Sequence:CCGGTGTTAGCTGCGTGCGTGCTTTCTCGAGAAAGCACGCACGCAGCTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-1003s1c1
Sequence:CCGGCCCATGGAGATCCTCATCAATCTCGAGATTGATGAGGATCTCCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-348s1c1
Sequence:CCGGCCTGAGCCAGAAGGAGACCATCTCGAGATGGTCTCCTTCTGGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-209s1c1
Sequence:CCGGCGACGCGCTTCATCTGCACTTCTCGAGAAGTGCAGATGAAGCGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002522.1-832s1c1
Sequence:CCGGCTGCGGACCAACTATATGTATCTCGAGATACATATAGTTGGTCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-534s1c1
Sequence:CCGGGCAAACTTTGCAATCGCTCAACTCGAGTTGAGCGATTGCAAAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002522
VALIDATED
NPTX1 MISSION shRNA Lentiviral Transduction Particles
neuronal pentraxin I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-901s21c1
Sequence:CCGGCAGAGATGTACGCCTTCACTGCTCGAGCAGTGAAGGCGTACATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-604s21c1
Sequence:CCGGAGTACAGCCGCCTCAATTCCTCTCGAGAGGAATTGAGGCGGCTGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002522.3-997s21c1
Sequence:CCGGACGAGCTGGTCCTCATTGAGTCTCGAGACTCAATGAGGACCAGCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002522.3-1896s21c1
Sequence:CCGGTGTTAGCTGCGTGCGTGCTTTCTCGAGAAAGCACGCACGCAGCTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-1003s1c1
Sequence:CCGGCCCATGGAGATCCTCATCAATCTCGAGATTGATGAGGATCTCCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-348s1c1
Sequence:CCGGCCTGAGCCAGAAGGAGACCATCTCGAGATGGTCTCCTTCTGGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-209s1c1
Sequence:CCGGCGACGCGCTTCATCTGCACTTCTCGAGAAGTGCAGATGAAGCGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002522.1-832s1c1
Sequence:CCGGCTGCGGACCAACTATATGTATCTCGAGATACATATAGTTGGTCCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002522.1-534s1c1
Sequence:CCGGGCAAACTTTGCAATCGCTCAACTCGAGTTGAGCGATTGCAAAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008730
VALIDATED
NPTX1 MISSION shRNA Bacterial Glycerol Stock
neuronal pentraxin I
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-932s21c1
Sequence:CCGGTGCGGACCAACTACATGTATGCTCGAGCATACATGTAGTTGGTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-1463s21c1
Sequence:CCGGAGTCCCAGATCGAGATCTTTGCTCGAGCAAAGATCTCGATCTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279436    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-4030s21c1
Sequence:CCGGCGCAAATCTAATCCGCATATTCTCGAGAATATGCGGATTAGATTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-905s21c1
Sequence:CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGCTGAAACTTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008730.1-902s1c1
Sequence:CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGCTGAAACTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008730.1-1134s1c1
Sequence:CCGGGCTGCCGTTTGTAATCAACGACTCGAGTCGTTGATTACAAACGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008730.1-4023s1c1
Sequence:CCGGCGCAAATCTAATCCGCATATTCTCGAGAATATGCGGATTAGATTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008730.1-1336s1c1
Sequence:CCGGCAAGCATTTGTGGGTGAGCTACTCGAGTAGCTCACCCACAAATGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008730
VALIDATED
NPTX1 MISSION shRNA shRNA Plasmid DNA
neuronal pentraxin I
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-932s21c1
Sequence:CCGGTGCGGACCAACTACATGTATGCTCGAGCATACATGTAGTTGGTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-1463s21c1
Sequence:CCGGAGTCCCAGATCGAGATCTTTGCTCGAGCAAAGATCTCGATCTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279436    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-4030s21c1
Sequence:CCGGCGCAAATCTAATCCGCATATTCTCGAGAATATGCGGATTAGATTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-905s21c1
Sequence:CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGCTGAAACTTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008730.1-902s1c1
Sequence:CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGCTGAAACTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008730.1-1134s1c1
Sequence:CCGGGCTGCCGTTTGTAATCAACGACTCGAGTCGTTGATTACAAACGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008730.1-4023s1c1
Sequence:CCGGCGCAAATCTAATCCGCATATTCTCGAGAATATGCGGATTAGATTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008730.1-1336s1c1
Sequence:CCGGCAAGCATTTGTGGGTGAGCTACTCGAGTAGCTCACCCACAAATGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008730
VALIDATED
NPTX1 MISSION shRNA Lentiviral Transduction Particles
neuronal pentraxin I
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-932s21c1
Sequence:CCGGTGCGGACCAACTACATGTATGCTCGAGCATACATGTAGTTGGTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-1463s21c1
Sequence:CCGGAGTCCCAGATCGAGATCTTTGCTCGAGCAAAGATCTCGATCTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279436    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-4030s21c1
Sequence:CCGGCGCAAATCTAATCCGCATATTCTCGAGAATATGCGGATTAGATTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008730.2-905s21c1
Sequence:CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGCTGAAACTTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008730.1-902s1c1
Sequence:CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGCTGAAACTTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008730.1-1134s1c1
Sequence:CCGGGCTGCCGTTTGTAATCAACGACTCGAGTCGTTGATTACAAACGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008730.1-4023s1c1
Sequence:CCGGCGCAAATCTAATCCGCATATTCTCGAGAATATGCGGATTAGATTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008730.1-1336s1c1
Sequence:CCGGCAAGCATTTGTGGGTGAGCTACTCGAGTAGCTCACCCACAAATGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)