EMAIL THIS PAGE TO A FRIEND

NPTX2

neuronal pentraxin II

47 Gene Product Result for
Synonyms: NARP NP-II NP2
UniProtKB ID: P47972, A4D267, Q86XV7, Q96G70
Gene ID:
Human(4885) Summary: This gene encodes a member of the family of neuronal petraxins, synaptic proteins that are related to C-reactive protein. This protein is involved in excitatory synapse formation. It also plays a role in clustering of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-type glutamate receptors at established synapses, resulting in non-apoptotic cell death of dopaminergic nerve cells. Up-regulation of this gene in Parkinson disease (PD) tissues suggests that the protein may be involved in the pathology of PD. [provided by RefSeq, Feb 2009]
Mouse(53324) neuronal pentraxin 2
Rat(288475) neuronal pentraxin II
chicken(416438) neuronal pentraxin II
dog(489866) neuronal pentraxin II
domestic cat(101094720) neuronal pentraxin II
cow(100336779) neuronal pentraxin II
sheep(101104118) neuronal pentraxin II
naked mole-rat(101720728) neuronal pentraxin II
domestic guinea pig(100135579) neuronal pentraxin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002523 Rosetta Predictions human pricing
NM_001034199 Rosetta Predictions rat pricing
NM_016789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159463 predicted 1634
2 SASI_Hs02_00333994 predicted 1479
3 SASI_Hs01_00159464 predicted 859
4 SASI_Hs01_00159465 predicted 1060
5 SASI_Hs01_00159466 predicted 1541
6 SASI_Hs01_00159468 predicted 1431
7 SASI_Hs01_00159469 predicted 1530
8 SASI_Hs01_00159470 predicted 1602
9 SASI_Hs01_00159472 predicted 811
10 SASI_Hs02_00333995 predicted 1276
11 SASI_Hs01_00159467 predicted 1615
12 SASI_Hs01_00159471 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120595 predicted 980
2 SASI_Rn01_00120597 predicted 1057
3 SASI_Rn01_00120598 predicted 1544
4 SASI_Rn01_00120599 predicted 1261
5 SASI_Rn01_00120600 predicted 835
6 SASI_Rn01_00120601 predicted 253
7 SASI_Rn01_00120602 predicted 1017
8 SASI_Rn01_00120603 predicted 593
9 SASI_Rn01_00120604 predicted 912
10 SASI_Rn02_00204033 predicted 1375
11 SASI_Rn01_00120596 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106338 predicted 540
2 SASI_Mm01_00106339 predicted 1275
3 SASI_Mm02_00323568 predicted 1573
4 SASI_Mm01_00106340 predicted 804
5 SASI_Mm01_00106341 predicted 1347
6 SASI_Mm02_00323569 predicted 948
7 SASI_Mm01_00106344 predicted 996
8 SASI_Mm01_00106347 predicted 1611
9 SASI_Mm02_00323570 predicted 1283
10 SASI_Mm01_00106345 predicted 561
11 SASI_Mm01_00106342 predicted 1663
12 SASI_Mm01_00106343 predicted 852
13 SASI_Mm01_00106346 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002523
NPTX2 MISSION shRNA Bacterial Glycerol Stock
neuronal pentraxin II
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002523.2-1384s21c1
Sequence:CCGGATCCCGTGGGTGGACAATAACCTCGAGGTTATTGTCCACCCACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002523.2-725s21c1
Sequence:CCGGAGAAGTCCCTGCTGCACAATGCTCGAGCATTGTGCAGCAGGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002523.2-1518s21c1
Sequence:CCGGTGGAAGTTCAGGGCCATAGACCTCGAGGTCTATGGCCCTGAACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002523.1-1623s1c1
Sequence:CCGGGCTTGTTTGTTCCCTACCAATCTCGAGATTGGTAGGGAACAAACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-855s1c1
Sequence:CCGGACTCCGCACAAACTACCTATACTCGAGTATAGGTAGTTTGTGCGGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-1316s1c1
Sequence:CCGGGCGCACAAGAAATTGTCAACACTCGAGTGTTGACAATTTCTTGTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-804s1c1
Sequence:CCGGGCGAGGCAATAGCGCCTTTAACTCGAGTTAAAGGCGCTATTGCCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002523
NPTX2 MISSION shRNA shRNA Plasmid DNA
neuronal pentraxin II
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002523.2-1384s21c1
Sequence:CCGGATCCCGTGGGTGGACAATAACCTCGAGGTTATTGTCCACCCACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002523.2-725s21c1
Sequence:CCGGAGAAGTCCCTGCTGCACAATGCTCGAGCATTGTGCAGCAGGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002523.2-1518s21c1
Sequence:CCGGTGGAAGTTCAGGGCCATAGACCTCGAGGTCTATGGCCCTGAACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002523.1-1623s1c1
Sequence:CCGGGCTTGTTTGTTCCCTACCAATCTCGAGATTGGTAGGGAACAAACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-855s1c1
Sequence:CCGGACTCCGCACAAACTACCTATACTCGAGTATAGGTAGTTTGTGCGGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-1316s1c1
Sequence:CCGGGCGCACAAGAAATTGTCAACACTCGAGTGTTGACAATTTCTTGTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-804s1c1
Sequence:CCGGGCGAGGCAATAGCGCCTTTAACTCGAGTTAAAGGCGCTATTGCCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002523
NPTX2 MISSION shRNA Lentiviral Transduction Particles
neuronal pentraxin II
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002523.2-1384s21c1
Sequence:CCGGATCCCGTGGGTGGACAATAACCTCGAGGTTATTGTCCACCCACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002523.2-725s21c1
Sequence:CCGGAGAAGTCCCTGCTGCACAATGCTCGAGCATTGTGCAGCAGGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002523.2-1518s21c1
Sequence:CCGGTGGAAGTTCAGGGCCATAGACCTCGAGGTCTATGGCCCTGAACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002523.1-1623s1c1
Sequence:CCGGGCTTGTTTGTTCCCTACCAATCTCGAGATTGGTAGGGAACAAACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-855s1c1
Sequence:CCGGACTCCGCACAAACTACCTATACTCGAGTATAGGTAGTTTGTGCGGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-1316s1c1
Sequence:CCGGGCGCACAAGAAATTGTCAACACTCGAGTGTTGACAATTTCTTGTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002523.1-804s1c1
Sequence:CCGGGCGAGGCAATAGCGCCTTTAACTCGAGTTAAAGGCGCTATTGCCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016789
NPTX2 MISSION shRNA Bacterial Glycerol Stock
neuronal pentraxin II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-725s1c1
Sequence:CCGGCTTCATAATGAGACCTCGGCTCTCGAGAGCCGAGGTCTCATTATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-833s1c1
Sequence:CCGGGATGCATTCAAAGTGTCCCTTCTCGAGAAGGGACACTTTGAATGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-868s1c1
Sequence:CCGGCTACCTGTATGGCAAGATCAACTCGAGTTGATCTTGCCATACAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-707s1c1
Sequence:CCGGGAAGATGAGAAGTCCCTGCTTCTCGAGAAGCAGGGACTTCTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-889s1c1
Sequence:CCGGGAAGACATTGCCTGAGCTGTACTCGAGTACAGCTCAGGCAATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016789
NPTX2 MISSION shRNA shRNA Plasmid DNA
neuronal pentraxin II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-725s1c1
Sequence:CCGGCTTCATAATGAGACCTCGGCTCTCGAGAGCCGAGGTCTCATTATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-833s1c1
Sequence:CCGGGATGCATTCAAAGTGTCCCTTCTCGAGAAGGGACACTTTGAATGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-868s1c1
Sequence:CCGGCTACCTGTATGGCAAGATCAACTCGAGTTGATCTTGCCATACAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-707s1c1
Sequence:CCGGGAAGATGAGAAGTCCCTGCTTCTCGAGAAGCAGGGACTTCTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-889s1c1
Sequence:CCGGGAAGACATTGCCTGAGCTGTACTCGAGTACAGCTCAGGCAATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016789
NPTX2 MISSION shRNA Lentiviral Transduction Particles
neuronal pentraxin II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-725s1c1
Sequence:CCGGCTTCATAATGAGACCTCGGCTCTCGAGAGCCGAGGTCTCATTATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-833s1c1
Sequence:CCGGGATGCATTCAAAGTGTCCCTTCTCGAGAAGGGACACTTTGAATGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-868s1c1
Sequence:CCGGCTACCTGTATGGCAAGATCAACTCGAGTTGATCTTGCCATACAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-707s1c1
Sequence:CCGGGAAGATGAGAAGTCCCTGCTTCTCGAGAAGCAGGGACTTCTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016789.2-889s1c1
Sequence:CCGGGAAGACATTGCCTGAGCTGTACTCGAGTACAGCTCAGGCAATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)