EMAIL THIS PAGE TO A FRIEND

NPVF

neuropeptide VF precursor

48 Gene Product Result for
Synonyms: C7orf9 RFRP
UniProtKB ID: Q9HCQ7, A4D164, Q7LE27, Q96PI9
Gene ID:
Mouse(60531) neuropeptide VF precursor
Rat(60570) neuropeptide VF precursor
Zebrafish(100002108) neuropeptide VF precursor
chicken(378785) neuropeptide VF precursor
domestic cat(101098702) neuropeptide VF precursor
cow(281451) neuropeptide VF precursor
dog(100682920) neuropeptide VF precursor
sheep(100127217) neuropeptide VF precursor
naked mole-rat(101717813) neuropeptide VF precursor
Domestic Rabbit(100352082) neuropeptide VF precursor
domestic guinea pig(100714295) neuropeptide VF precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041733 Anti-NPVF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022150 Rosetta Predictions human pricing
NM_023952 Rosetta Predictions rat pricing
NM_021892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355564 predicted 576
2 SASI_Hs01_00183482 predicted 262
3 SASI_Hs01_00183483 predicted 439
4 SASI_Hs01_00183484 predicted 399
5 SASI_Hs01_00183485 predicted 498
6 SASI_Hs01_00183486 predicted 475
7 SASI_Hs02_00355565 predicted 311
8 SASI_Hs01_00183487 predicted 267
9 SASI_Hs01_00183488 predicted 509
10 SASI_Hs01_00183489 predicted 494
11 SASI_Hs01_00183490 predicted 534
12 SASI_Hs01_00183491 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119372 predicted 330
2 SASI_Rn01_00119373 predicted 330
3 SASI_Rn01_00119375 predicted 362
4 SASI_Rn01_00119376 predicted 268
5 SASI_Rn01_00119377 predicted 310
6 SASI_Rn01_00119378 predicted 381
7 SASI_Rn01_00119379 predicted 334
8 SASI_Rn01_00119380 predicted 385
9 SASI_Rn01_00119381 predicted 250
10 SASI_Rn02_00263751 predicted 274
11 SASI_Rn01_00119374 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091058 predicted 304
2 SASI_Mm01_00091059 predicted 266
3 SASI_Mm01_00091060 predicted 325
4 SASI_Mm01_00091061 predicted 282
5 SASI_Mm01_00091062 predicted 281
6 SASI_Mm01_00091064 predicted 202
7 SASI_Mm01_00091065 predicted 306
8 SASI_Mm01_00091066 predicted 268
9 SASI_Mm01_00091067 predicted 269
10 SASI_Mm02_00326459 predicted 273
11 SASI_Mm01_00091063 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021892
NPVF MISSION shRNA Bacterial Glycerol Stock
neuropeptide VF precursor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-273s1c1
Sequence:CCGGCCTGAGATTTGGAAGGACCATCTCGAGATGGTCCTTCCAAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-69s1c1
Sequence:CCGGCACCTTCTGTACAGATGAGTTCTCGAGAACTCATCTGTACAGAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-134s1c1
Sequence:CCGGCCCAGCTGAGAGGAATCCCAACTCGAGTTGGGATTCCTCTCAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-54s1c1
Sequence:CCGGCTTCTTAACATCAAACACCTTCTCGAGAAGGTGTTTGATGTTAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-406s1c1
Sequence:CCGGCCCGCTGATTTGCCACAGAAACTCGAGTTTCTGTGGCAAATCAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021892
NPVF MISSION shRNA shRNA Plasmid DNA
neuropeptide VF precursor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-273s1c1
Sequence:CCGGCCTGAGATTTGGAAGGACCATCTCGAGATGGTCCTTCCAAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-69s1c1
Sequence:CCGGCACCTTCTGTACAGATGAGTTCTCGAGAACTCATCTGTACAGAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-134s1c1
Sequence:CCGGCCCAGCTGAGAGGAATCCCAACTCGAGTTGGGATTCCTCTCAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-54s1c1
Sequence:CCGGCTTCTTAACATCAAACACCTTCTCGAGAAGGTGTTTGATGTTAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-406s1c1
Sequence:CCGGCCCGCTGATTTGCCACAGAAACTCGAGTTTCTGTGGCAAATCAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021892
NPVF MISSION shRNA Lentiviral Transduction Particles
neuropeptide VF precursor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-273s1c1
Sequence:CCGGCCTGAGATTTGGAAGGACCATCTCGAGATGGTCCTTCCAAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-69s1c1
Sequence:CCGGCACCTTCTGTACAGATGAGTTCTCGAGAACTCATCTGTACAGAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-134s1c1
Sequence:CCGGCCCAGCTGAGAGGAATCCCAACTCGAGTTGGGATTCCTCTCAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-54s1c1
Sequence:CCGGCTTCTTAACATCAAACACCTTCTCGAGAAGGTGTTTGATGTTAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021892.1-406s1c1
Sequence:CCGGCCCGCTGATTTGCCACAGAAACTCGAGTTTCTGTGGCAAATCAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022150
NPVF MISSION shRNA Bacterial Glycerol Stock
neuropeptide VF precursor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022150.2-1017s1c1
Sequence:CCGGCCAGAATAACATGGTTGACAACTCGAGTTGTCAACCATGTTATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-311s1c1
Sequence:CCGGGCCATTGAGATTTGGGAGGAACTCGAGTTCCTCCCAAATCTCAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-546s1c1
Sequence:CCGGCAGCACCAAGAAATCCAGAATCTCGAGATTCTGGATTTCTTGGTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-612s1c1
Sequence:CCGGGATGCAGAATTGAAACAAGAACTCGAGTTCTTGTTTCAATTCTGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-266s21c1
Sequence:CCGGGAGTACACCTGCAGTCAATAACTCGAGTTATTGACTGCAGGTGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022150.3-761s21c1
Sequence:CCGGCTTGTCAGTACAGCTATAATACTCGAGTATTATAGCTGTACTGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-510s21c1
Sequence:CCGGCCATGTGCCAATGACTTATTTCTCGAGAAATAAGTCATTGGCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-88s21c1
Sequence:CCGGTAGCCACTTCAAGCTTGTTAACTCGAGTTAACAAGCTTGAAGTGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022150.3-737s21c1
Sequence:CCGGATGGATCATCAACGGCAATTTCTCGAGAAATTGCCGTTGATGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022150
NPVF MISSION shRNA shRNA Plasmid DNA
neuropeptide VF precursor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022150.2-1017s1c1
Sequence:CCGGCCAGAATAACATGGTTGACAACTCGAGTTGTCAACCATGTTATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-311s1c1
Sequence:CCGGGCCATTGAGATTTGGGAGGAACTCGAGTTCCTCCCAAATCTCAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-546s1c1
Sequence:CCGGCAGCACCAAGAAATCCAGAATCTCGAGATTCTGGATTTCTTGGTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-612s1c1
Sequence:CCGGGATGCAGAATTGAAACAAGAACTCGAGTTCTTGTTTCAATTCTGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-266s21c1
Sequence:CCGGGAGTACACCTGCAGTCAATAACTCGAGTTATTGACTGCAGGTGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022150.3-761s21c1
Sequence:CCGGCTTGTCAGTACAGCTATAATACTCGAGTATTATAGCTGTACTGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-510s21c1
Sequence:CCGGCCATGTGCCAATGACTTATTTCTCGAGAAATAAGTCATTGGCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-88s21c1
Sequence:CCGGTAGCCACTTCAAGCTTGTTAACTCGAGTTAACAAGCTTGAAGTGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022150.3-737s21c1
Sequence:CCGGATGGATCATCAACGGCAATTTCTCGAGAAATTGCCGTTGATGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022150
NPVF MISSION shRNA Lentiviral Transduction Particles
neuropeptide VF precursor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022150.2-1017s1c1
Sequence:CCGGCCAGAATAACATGGTTGACAACTCGAGTTGTCAACCATGTTATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-311s1c1
Sequence:CCGGGCCATTGAGATTTGGGAGGAACTCGAGTTCCTCCCAAATCTCAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-546s1c1
Sequence:CCGGCAGCACCAAGAAATCCAGAATCTCGAGATTCTGGATTTCTTGGTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022150.2-612s1c1
Sequence:CCGGGATGCAGAATTGAAACAAGAACTCGAGTTCTTGTTTCAATTCTGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-266s21c1
Sequence:CCGGGAGTACACCTGCAGTCAATAACTCGAGTTATTGACTGCAGGTGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022150.3-761s21c1
Sequence:CCGGCTTGTCAGTACAGCTATAATACTCGAGTATTATAGCTGTACTGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-510s21c1
Sequence:CCGGCCATGTGCCAATGACTTATTTCTCGAGAAATAAGTCATTGGCACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022150.3-88s21c1
Sequence:CCGGTAGCCACTTCAAGCTTGTTAACTCGAGTTAACAAGCTTGAAGTGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022150.3-737s21c1
Sequence:CCGGATGGATCATCAACGGCAATTTCTCGAGAAATTGCCGTTGATGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)