EMAIL THIS PAGE TO A FRIEND

NPY4R

neuropeptide Y receptor Y4

97 Gene Product Result for
Synonyms: NPY4-R PP1 PPYR1 Y4
UniProtKB ID: P50391, Q13456, Q5ISU3, Q5T2X9, Q6FH06
Gene ID:
Mouse(19065) neuropeptide Y receptor Y4
Rat(29471) neuropeptide Y receptor Y4
Zebrafish(30717) neuropeptide Y receptor Y4
naked mole-rat(101715129) neuropeptide Y receptor Y4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102621 MISSION® esiRNA esiRNA human PPYR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005972 Rosetta Predictions human pricing
NM_031581 Rosetta Predictions rat pricing
NM_008919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078872 predicted 1500
2 SASI_Hs01_00078873 predicted 988
3 SASI_Hs01_00078874 predicted 769
4 SASI_Hs01_00078875 predicted 1039
5 SASI_Hs01_00078876 predicted 1583
6 SASI_Hs01_00078877 predicted 722
7 SASI_Hs01_00078878 predicted 1678
8 SASI_Hs02_00340652 predicted 1683
9 SASI_Hs01_00078879 predicted 830
10 SASI_Hs02_00340653 predicted 1364
11 SASI_Hs01_00078870 predicted 607
12 SASI_Hs01_00078871 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110374 predicted 226
2 SASI_Rn01_00110375 predicted 314
3 SASI_Rn01_00110376 predicted 392
4 SASI_Rn01_00110377 predicted 602
5 SASI_Rn01_00110378 predicted 838
6 SASI_Rn01_00110379 predicted 295
7 SASI_Rn01_00110380 predicted 677
8 SASI_Rn01_00110382 predicted 580
9 SASI_Rn01_00110383 predicted 623
10 SASI_Rn02_00264843 predicted 225
11 SASI_Rn01_00110381 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077788 predicted 1418
2 SASI_Mm01_00077789 predicted 1319
3 SASI_Mm01_00077790 predicted 982
4 SASI_Mm01_00077791 predicted 781
5 SASI_Mm01_00077792 predicted 994
6 SASI_Mm01_00077793 predicted 986
7 SASI_Mm01_00077794 predicted 1382
8 SASI_Mm01_00077795 predicted 1291
9 SASI_Mm01_00077796 predicted 1410
10 SASI_Mm01_00077797 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005972
NPY4R MISSION shRNA Bacterial Glycerol Stock
neuropeptide Y receptor Y4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-164s1c1
Sequence:CCGGCCATACAACTTCTCTGAACATCTCGAGATGTTCAGAGAAGTTGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-992s21c1
Sequence:CCGGTCTGGAGTTCCTGGCGGATAACTCGAGTTATCCGCCAGGAACTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-1145s1c1
Sequence:CCGGCTGTCCACAGTACATACGGAACTCGAGTTCCGTATGTACTGTGGACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-622s1c1
Sequence:CCGGCCTGGAGAATGTCTTCCACAACTCGAGTTGTGGAAGACATTCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005972.2-1391s1c1
Sequence:CCGGGCTGTTTGTTCCTGGGAGAATCTCGAGATTCTCCCAGGAACAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-775s1c1
Sequence:CCGGCTTGGTCTGTTATGCACGCATCTCGAGATGCGTGCATAACAGACCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005972.4-1694s21c1
Sequence:CCGGGCATCGTGAAGACTGGCATTTCTCGAGAAATGCCAGTCTTCACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-638s21c1
Sequence:CCGGCAACGTGACCAACCTGCTTATCTCGAGATAAGCAGGTTGGTCACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-1366s21c1
Sequence:CCGGGCGTCAACCCATTCATCTATGCTCGAGCATAGATGAATGGGTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005972
NPY4R MISSION shRNA shRNA Plasmid DNA
neuropeptide Y receptor Y4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-164s1c1
Sequence:CCGGCCATACAACTTCTCTGAACATCTCGAGATGTTCAGAGAAGTTGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-992s21c1
Sequence:CCGGTCTGGAGTTCCTGGCGGATAACTCGAGTTATCCGCCAGGAACTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-1145s1c1
Sequence:CCGGCTGTCCACAGTACATACGGAACTCGAGTTCCGTATGTACTGTGGACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-622s1c1
Sequence:CCGGCCTGGAGAATGTCTTCCACAACTCGAGTTGTGGAAGACATTCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005972.2-1391s1c1
Sequence:CCGGGCTGTTTGTTCCTGGGAGAATCTCGAGATTCTCCCAGGAACAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-775s1c1
Sequence:CCGGCTTGGTCTGTTATGCACGCATCTCGAGATGCGTGCATAACAGACCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005972.4-1694s21c1
Sequence:CCGGGCATCGTGAAGACTGGCATTTCTCGAGAAATGCCAGTCTTCACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-638s21c1
Sequence:CCGGCAACGTGACCAACCTGCTTATCTCGAGATAAGCAGGTTGGTCACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-1366s21c1
Sequence:CCGGGCGTCAACCCATTCATCTATGCTCGAGCATAGATGAATGGGTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005972
NPY4R MISSION shRNA Lentiviral Transduction Particles
neuropeptide Y receptor Y4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-164s1c1
Sequence:CCGGCCATACAACTTCTCTGAACATCTCGAGATGTTCAGAGAAGTTGTATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-992s21c1
Sequence:CCGGTCTGGAGTTCCTGGCGGATAACTCGAGTTATCCGCCAGGAACTCCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-1145s1c1
Sequence:CCGGCTGTCCACAGTACATACGGAACTCGAGTTCCGTATGTACTGTGGACAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-622s1c1
Sequence:CCGGCCTGGAGAATGTCTTCCACAACTCGAGTTGTGGAAGACATTCTCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005972.2-1391s1c1
Sequence:CCGGGCTGTTTGTTCCTGGGAGAATCTCGAGATTCTCCCAGGAACAAACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005972.2-775s1c1
Sequence:CCGGCTTGGTCTGTTATGCACGCATCTCGAGATGCGTGCATAACAGACCAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005972.4-1694s21c1
Sequence:CCGGGCATCGTGAAGACTGGCATTTCTCGAGAAATGCCAGTCTTCACGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-638s21c1
Sequence:CCGGCAACGTGACCAACCTGCTTATCTCGAGATAAGCAGGTTGGTCACGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005972.4-1366s21c1
Sequence:CCGGGCGTCAACCCATTCATCTATGCTCGAGCATAGATGAATGGGTTGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008919
NPY4R MISSION shRNA Bacterial Glycerol Stock
neuropeptide Y receptor Y4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008919.4-391s21c1
Sequence:CCGGGGAAACCTCTGCTTGATATTTCTCGAGAAATATCAAGCAGAGGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-839s1c1
Sequence:CCGGCTTCCACTACAACCACTCTAACTCGAGTTAGAGTGGTTGTAGTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-1268s1c1
Sequence:CCGGCATCAACTTCAAGAAGGATATCTCGAGATATCCTTCTTGAAGTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-920s1c1
Sequence:CCGGCCGTCTCATCTATACCACTTTCTCGAGAAAGTGGTATAGATGAGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-336s1c1
Sequence:CCGGCAGGGTAAGAATGGGACCAATCTCGAGATTGGTCCCATTCTTACCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-1396s1c1
Sequence:CCGGGTAGCAAGTCTAACTTCATATCTCGAGATATGAAGTTAGACTTGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008919.4-1419s21c1
Sequence:CCGGGTGATAGCATCCTGTCATTTCCTCGAGGAAATGACAGGATGCTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008919
NPY4R MISSION shRNA shRNA Plasmid DNA
neuropeptide Y receptor Y4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008919.4-391s21c1
Sequence:CCGGGGAAACCTCTGCTTGATATTTCTCGAGAAATATCAAGCAGAGGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-839s1c1
Sequence:CCGGCTTCCACTACAACCACTCTAACTCGAGTTAGAGTGGTTGTAGTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-1268s1c1
Sequence:CCGGCATCAACTTCAAGAAGGATATCTCGAGATATCCTTCTTGAAGTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-920s1c1
Sequence:CCGGCCGTCTCATCTATACCACTTTCTCGAGAAAGTGGTATAGATGAGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-336s1c1
Sequence:CCGGCAGGGTAAGAATGGGACCAATCTCGAGATTGGTCCCATTCTTACCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-1396s1c1
Sequence:CCGGGTAGCAAGTCTAACTTCATATCTCGAGATATGAAGTTAGACTTGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008919.4-1419s21c1
Sequence:CCGGGTGATAGCATCCTGTCATTTCCTCGAGGAAATGACAGGATGCTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008919
NPY4R MISSION shRNA Lentiviral Transduction Particles
neuropeptide Y receptor Y4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008919.4-391s21c1
Sequence:CCGGGGAAACCTCTGCTTGATATTTCTCGAGAAATATCAAGCAGAGGTTTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-839s1c1
Sequence:CCGGCTTCCACTACAACCACTCTAACTCGAGTTAGAGTGGTTGTAGTGGAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-1268s1c1
Sequence:CCGGCATCAACTTCAAGAAGGATATCTCGAGATATCCTTCTTGAAGTTGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-920s1c1
Sequence:CCGGCCGTCTCATCTATACCACTTTCTCGAGAAAGTGGTATAGATGAGACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-336s1c1
Sequence:CCGGCAGGGTAAGAATGGGACCAATCTCGAGATTGGTCCCATTCTTACCCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008919.2-1396s1c1
Sequence:CCGGGTAGCAAGTCTAACTTCATATCTCGAGATATGAAGTTAGACTTGCTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008919.4-1419s21c1
Sequence:CCGGGTGATAGCATCCTGTCATTTCCTCGAGGAAATGACAGGATGCTATCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)