EMAIL THIS PAGE TO A FRIEND

NPY5R

neuropeptide Y receptor Y5

56 Gene Product Result for
Synonyms: NPY5-R NPYR5 NPYY5-R
UniProtKB ID: Q15761, Q6GTR7, Q92916
Gene ID:
Mouse(18168) neuropeptide Y receptor Y5
Rat(25340) neuropeptide Y receptor Y5
chicken(422419) neuropeptide Y receptor Y5
domestic cat(101099631) neuropeptide Y receptor Y5
cow(781872) neuropeptide Y receptor Y5
cow(786150) neuropeptide Y receptor Y5
Horse(100061647) neuropeptide Y receptor Y5
dog(403712) neuropeptide Y receptor Y5
sheep(101106846) neuropeptide Y receptor Y5
naked mole-rat(101726387) neuropeptide Y receptor Y5
Domestic Rabbit(100301541) neuropeptide Y receptor Y5
domestic guinea pig(100379614) neuropeptide Y receptor Y5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006174 Rosetta Predictions human pricing
NM_012869 Rosetta Predictions rat pricing
NM_016708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190537 predicted 579
2 SASI_Hs01_00190538 predicted 1033
3 SASI_Hs01_00190539 predicted 779
4 SASI_Hs01_00190540 predicted 310
5 SASI_Hs01_00190541 predicted 1219
6 SASI_Hs01_00190542 predicted 402
7 SASI_Hs01_00190543 predicted 939
8 SASI_Hs01_00190544 predicted 502
9 SASI_Hs02_00341033 predicted 728
10 SASI_Hs01_00190545 predicted 747
11 SASI_Hs01_00190546 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260358 predicted 1601
2 SASI_Rn01_00106348 predicted 1434
3 SASI_Rn01_00106350 predicted 1562
4 SASI_Rn01_00106352 predicted 1231
5 SASI_Rn01_00106353 predicted 401
6 SASI_Rn02_00260359 predicted 1594
7 SASI_Rn01_00106354 predicted 1276
8 SASI_Rn01_00106355 predicted 367
9 SASI_Rn01_00106356 predicted 892
10 SASI_Rn02_00260360 predicted 384
11 SASI_Rn01_00106347 predicted 1498
12 SASI_Rn01_00106349 predicted 603
13 SASI_Rn01_00106351 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167236 predicted 1386
2 SASI_Mm01_00167237 predicted 1522
3 SASI_Mm01_00167238 predicted 1069
4 SASI_Mm01_00167239 predicted 744
5 SASI_Mm01_00167240 predicted 878
6 SASI_Mm01_00167241 predicted 635
7 SASI_Mm01_00167242 predicted 1466
8 SASI_Mm01_00167244 predicted 334
9 SASI_Mm01_00167243 predicted 869
10 SASI_Mm01_00167245 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006174
NPY5R MISSION shRNA Bacterial Glycerol Stock
neuropeptide Y receptor Y5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-264s21c1
Sequence:CCGGCCAGTCTGGGATGACTATAAACTCGAGTTTATAGTCATCCCAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-1287s21c1
Sequence:CCGGAGACTGACCATACTGATATTACTCGAGTAATATCAGTATGGTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-1482s1c1
Sequence:CCGGGCTGATTTAGTGTCCCTTATACTCGAGTATAAGGGACACTAAATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006174.2-1774s1c1
Sequence:CCGGCCACTTCCATGTTGTCTTATACTCGAGTATAAGACAACATGGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-788s1c1
Sequence:CCGGGCCATCTGATTCATACAGAATCTCGAGATTCTGTATGAATCAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-1000s1c1
Sequence:CCGGGCAGCCATAAATGGAGTTATTCTCGAGAATAACTCCATTTATGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-753s21c1
Sequence:CCGGTTGCTGAGCAGCAGGTATTTACTCGAGTAAATACCTGCTGCTCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-850s1c1
Sequence:CCGGCCTTAGTTTGTCTTACTGTAACTCGAGTTACAGTAAGACAAACTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006174
NPY5R MISSION shRNA shRNA Plasmid DNA
neuropeptide Y receptor Y5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-264s21c1
Sequence:CCGGCCAGTCTGGGATGACTATAAACTCGAGTTTATAGTCATCCCAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-1287s21c1
Sequence:CCGGAGACTGACCATACTGATATTACTCGAGTAATATCAGTATGGTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-1482s1c1
Sequence:CCGGGCTGATTTAGTGTCCCTTATACTCGAGTATAAGGGACACTAAATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006174.2-1774s1c1
Sequence:CCGGCCACTTCCATGTTGTCTTATACTCGAGTATAAGACAACATGGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-788s1c1
Sequence:CCGGGCCATCTGATTCATACAGAATCTCGAGATTCTGTATGAATCAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-1000s1c1
Sequence:CCGGGCAGCCATAAATGGAGTTATTCTCGAGAATAACTCCATTTATGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-753s21c1
Sequence:CCGGTTGCTGAGCAGCAGGTATTTACTCGAGTAAATACCTGCTGCTCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-850s1c1
Sequence:CCGGCCTTAGTTTGTCTTACTGTAACTCGAGTTACAGTAAGACAAACTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006174
NPY5R MISSION shRNA Lentiviral Transduction Particles
neuropeptide Y receptor Y5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-264s21c1
Sequence:CCGGCCAGTCTGGGATGACTATAAACTCGAGTTTATAGTCATCCCAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-1287s21c1
Sequence:CCGGAGACTGACCATACTGATATTACTCGAGTAATATCAGTATGGTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-1482s1c1
Sequence:CCGGGCTGATTTAGTGTCCCTTATACTCGAGTATAAGGGACACTAAATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006174.2-1774s1c1
Sequence:CCGGCCACTTCCATGTTGTCTTATACTCGAGTATAAGACAACATGGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-788s1c1
Sequence:CCGGGCCATCTGATTCATACAGAATCTCGAGATTCTGTATGAATCAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-1000s1c1
Sequence:CCGGGCAGCCATAAATGGAGTTATTCTCGAGAATAACTCCATTTATGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006174.2-753s21c1
Sequence:CCGGTTGCTGAGCAGCAGGTATTTACTCGAGTAAATACCTGCTGCTCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006174.2-850s1c1
Sequence:CCGGCCTTAGTTTGTCTTACTGTAACTCGAGTTACAGTAAGACAAACTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016708
NPY5R MISSION shRNA Bacterial Glycerol Stock
neuropeptide Y receptor Y5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-811s1c1
Sequence:CCGGGCCCTCTGATTCATACAGAATCTCGAGATTCTGTATGAATCAGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-1261s1c1
Sequence:CCGGGCGTTCCCTCACGAGAATAAACTCGAGTTTATTCTCGTGAGGGAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-637s1c1
Sequence:CCGGGCACCCTATATCTAACAATTTCTCGAGAAATTGTTAGATATAGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-319s1c1
Sequence:CCGGCGACTTACAATACTTCCTGATCTCGAGATCAGGAAGTATTGTAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-1466s1c1
Sequence:CCGGCCGATCTTATATGGATTCCTTCTCGAGAAGGAATCCATATAAGATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016708
NPY5R MISSION shRNA shRNA Plasmid DNA
neuropeptide Y receptor Y5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-811s1c1
Sequence:CCGGGCCCTCTGATTCATACAGAATCTCGAGATTCTGTATGAATCAGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-1261s1c1
Sequence:CCGGGCGTTCCCTCACGAGAATAAACTCGAGTTTATTCTCGTGAGGGAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-637s1c1
Sequence:CCGGGCACCCTATATCTAACAATTTCTCGAGAAATTGTTAGATATAGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-319s1c1
Sequence:CCGGCGACTTACAATACTTCCTGATCTCGAGATCAGGAAGTATTGTAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-1466s1c1
Sequence:CCGGCCGATCTTATATGGATTCCTTCTCGAGAAGGAATCCATATAAGATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016708
NPY5R MISSION shRNA Lentiviral Transduction Particles
neuropeptide Y receptor Y5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-811s1c1
Sequence:CCGGGCCCTCTGATTCATACAGAATCTCGAGATTCTGTATGAATCAGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-1261s1c1
Sequence:CCGGGCGTTCCCTCACGAGAATAAACTCGAGTTTATTCTCGTGAGGGAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-637s1c1
Sequence:CCGGGCACCCTATATCTAACAATTTCTCGAGAAATTGTTAGATATAGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-319s1c1
Sequence:CCGGCGACTTACAATACTTCCTGATCTCGAGATCAGGAAGTATTGTAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016708.1-1466s1c1
Sequence:CCGGCCGATCTTATATGGATTCCTTCTCGAGAAGGAATCCATATAAGATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)