EMAIL THIS PAGE TO A FRIEND

NQO1

NAD(P)H dehydrogenase, quinone 1

110 Gene Product Result for
Synonyms: DHQU DIA4 DTD NMOR1 NMORI QR1
UniProtKB ID: P15559, B2R5Y9, B4DNM7, B7ZAD1, Q86UK1
Gene ID:
Human(1728) Summary: This gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of this protein has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(18104) NAD(P)H dehydrogenase, quinone 1
Rat(24314) NAD(P)H dehydrogenase, quinone 1
sheep(101121876) NAD(P)H dehydrogenase, quinone 1
naked mole-rat(101711262) NAD(P)H dehydrogenase, quinone 1
domestic guinea pig(100135582) NAD(P)H dehydrogenase, quinone 1
Zebrafish(322506) NAD(P)H dehydrogenase, quinone 1
dog(610935) NAD(P)H dehydrogenase, quinone 1
domestic cat(101097859) NAD(P)H dehydrogenase, quinone 1
cow(519632) NAD(P)H dehydrogenase, quinone 1
chicken(769737) NAD(P)H dehydrogenase, quinone 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104993 Anti-NQO1 (59-70) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
N5288 Anti-NQO1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2500708 Anti-NQO1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, pig
ELISA, western blot pricing
SAB2501434 Anti-NQO1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, bovine, canine
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1408944 Anti-NQO1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA007308 Anti-NQO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410299 Anti-NQO1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
WH0001728M1 Monoclonal Anti-NQO1 antibody produced in mouse clone 1E3-A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB5300232 Monoclonal Anti-NQO1 antibody produced in mouse clone 4D12, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB5300233 Monoclonal Anti-NQO1 antibody produced in mouse clone 1A11, ascites fluid human
ELISA, flow cytometry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1605 Human NQO-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000903 Rosetta Predictions human pricing
NM_001025433 Rosetta Predictions human pricing
NM_001025434 Rosetta Predictions human pricing
NM_017000 Rosetta Predictions rat pricing
NM_008706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052548 predicted 1240
2 SASI_Hs01_00052549 predicted 226
3 SASI_Hs01_00052550 predicted 971
4 SASI_Hs01_00052551 predicted 1229
5 SASI_Hs02_00303470 predicted 205
6 SASI_Hs01_00052552 predicted 1351
7 SASI_Hs01_00052553 predicted 1026
8 SASI_Hs01_00052554 predicted 1362
9 SASI_Hs01_00052555 predicted 1274
10 SASI_Hs02_00303471 predicted 944
11 SASI_Hs01_00052556 predicted 227
12 SASI_Hs01_00052557 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232122 predicted 1137
2 SASI_Hs01_00232123 predicted 228
3 SASI_Hs01_00232124 predicted 867
4 SASI_Hs01_00232125 predicted 1128
5 SASI_Hs02_00307457 predicted 205
6 SASI_Hs01_00232126 predicted 1245
7 SASI_Hs01_00232127 predicted 924
8 SASI_Hs01_00232128 predicted 1256
9 SASI_Hs01_00232129 predicted 1176
10 SASI_Hs02_00307458 predicted 848
11 SASI_Hs01_00232130 predicted 232
12 SASI_Hs01_00232131 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073451 predicted 1130
2 SASI_Hs01_00073452 predicted 222
3 SASI_Hs01_00073453 predicted 856
4 SASI_Hs01_00073454 predicted 1118
5 SASI_Hs02_00307459 predicted 201
6 SASI_Hs01_00073455 predicted 1239
7 SASI_Hs01_00073456 predicted 912
8 SASI_Hs01_00073457 predicted 1242
9 SASI_Hs01_00073458 predicted 1160
10 SASI_Hs02_00307460 predicted 831
11 SASI_Hs01_00073459 predicted 224
12 SASI_Hs01_00073460 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261146 predicted 210
2 SASI_Rn01_00088450 predicted 330
3 SASI_Rn02_00261147 predicted 950
4 SASI_Rn02_00261148 predicted 422
5 SASI_Rn02_00261149 predicted 209
6 SASI_Rn01_00088453 predicted 229
7 SASI_Rn01_00088454 predicted 590
8 SASI_Rn01_00088455 predicted 291
9 SASI_Rn01_00088456 predicted 447
10 SASI_Rn01_00088457 predicted 645
11 SASI_Rn01_00088449 predicted 321
12 SASI_Rn01_00088451 predicted 369
13 SASI_Rn01_00088452 predicted 1202
14 SASI_Rn01_00088458 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314526 predicted 532
2 SASI_Mm02_00314527 predicted 410
3 SASI_Mm01_00133078 predicted 462
4 SASI_Mm01_00133081 predicted 418
5 SASI_Mm02_00314528 predicted 491
6 SASI_Mm02_00314529 predicted 486
7 SASI_Mm02_00314530 predicted 315
8 SASI_Mm02_00314531 predicted 381
9 SASI_Mm02_00314532 predicted 244
10 SASI_Mm02_00314533 predicted 803
11 SASI_Mm01_00133075 predicted 220
12 SASI_Mm01_00133076 predicted 458
13 SASI_Mm01_00133077 predicted 671
14 SASI_Mm01_00133079 predicted 422
15 SASI_Mm01_00133080 predicted 593
16 SASI_Mm01_00133082 predicted 223
17 SASI_Mm01_00133083 predicted 907
18 SASI_Mm01_00133084 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000903
VALIDATED
NQO1 MISSION shRNA Bacterial Glycerol Stock
NAD(P)H dehydrogenase, quinone 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-401s21c1
Sequence:CCGGCGAGTCTGTTCTGGCTTATAACTCGAGTTATAAGCCAGAACAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-476s21c1
Sequence:CCGGAGACCTTGTGATATTCCAGTTCTCGAGAACTGGAATATCACAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-546s21c1
Sequence:CCGGCGAGTGTTCATAGGAGAGTTTCTCGAGAAACTCTCCTATGAACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000903.2-1189s21c1
Sequence:CCGGGATTACTATCATGGCATATAACTCGAGTTATATGCCATGATAGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-813s21c1
Sequence:CCGGTGGAAGAAACGCCTGGAGAATCTCGAGATTCTCCAGGCGTTTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000903.x-207s1c1
Sequence:CCGGAGAAAGGACATCACAGGTAAACTCGAGTTTACCTGTGATGTCCTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-672s1c1
Sequence:CCGGTGGAAGAAACGCCTGGAGAATCTCGAGATTCTCCAGGCGTTTCTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-335s1c1
Sequence:CCGGAGACCTTGTGATATTCCAGTTCTCGAGAACTGGAATATCACAAGGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-903s1c1
Sequence:CCGGCATGTTATCAAATCTGGGTATCTCGAGATACCCAGATTTGATAACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-405s1c1
Sequence:CCGGCGAGTGTTCATAGGAGAGTTTCTCGAGAAACTCTCCTATGAACACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000903
VALIDATED
NQO1 MISSION shRNA shRNA Plasmid DNA
NAD(P)H dehydrogenase, quinone 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-401s21c1
Sequence:CCGGCGAGTCTGTTCTGGCTTATAACTCGAGTTATAAGCCAGAACAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-476s21c1
Sequence:CCGGAGACCTTGTGATATTCCAGTTCTCGAGAACTGGAATATCACAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-546s21c1
Sequence:CCGGCGAGTGTTCATAGGAGAGTTTCTCGAGAAACTCTCCTATGAACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000903.2-1189s21c1
Sequence:CCGGGATTACTATCATGGCATATAACTCGAGTTATATGCCATGATAGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-813s21c1
Sequence:CCGGTGGAAGAAACGCCTGGAGAATCTCGAGATTCTCCAGGCGTTTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000903.x-207s1c1
Sequence:CCGGAGAAAGGACATCACAGGTAAACTCGAGTTTACCTGTGATGTCCTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-672s1c1
Sequence:CCGGTGGAAGAAACGCCTGGAGAATCTCGAGATTCTCCAGGCGTTTCTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-335s1c1
Sequence:CCGGAGACCTTGTGATATTCCAGTTCTCGAGAACTGGAATATCACAAGGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-903s1c1
Sequence:CCGGCATGTTATCAAATCTGGGTATCTCGAGATACCCAGATTTGATAACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-405s1c1
Sequence:CCGGCGAGTGTTCATAGGAGAGTTTCTCGAGAAACTCTCCTATGAACACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000903
VALIDATED
NQO1 MISSION shRNA Lentiviral Transduction Particles
NAD(P)H dehydrogenase, quinone 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-401s21c1
Sequence:CCGGCGAGTCTGTTCTGGCTTATAACTCGAGTTATAAGCCAGAACAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-476s21c1
Sequence:CCGGAGACCTTGTGATATTCCAGTTCTCGAGAACTGGAATATCACAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-546s21c1
Sequence:CCGGCGAGTGTTCATAGGAGAGTTTCTCGAGAAACTCTCCTATGAACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000903.2-1189s21c1
Sequence:CCGGGATTACTATCATGGCATATAACTCGAGTTATATGCCATGATAGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000903.2-813s21c1
Sequence:CCGGTGGAAGAAACGCCTGGAGAATCTCGAGATTCTCCAGGCGTTTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000903.x-207s1c1
Sequence:CCGGAGAAAGGACATCACAGGTAAACTCGAGTTTACCTGTGATGTCCTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-672s1c1
Sequence:CCGGTGGAAGAAACGCCTGGAGAATCTCGAGATTCTCCAGGCGTTTCTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-335s1c1
Sequence:CCGGAGACCTTGTGATATTCCAGTTCTCGAGAACTGGAATATCACAAGGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-903s1c1
Sequence:CCGGCATGTTATCAAATCTGGGTATCTCGAGATACCCAGATTTGATAACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000903.x-405s1c1
Sequence:CCGGCGAGTGTTCATAGGAGAGTTTCTCGAGAAACTCTCCTATGAACACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008706
VALIDATED
NQO1 MISSION shRNA Bacterial Glycerol Stock
NAD(P)H dehydrogenase, quinone 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008706.5-1243s21c1
Sequence:CCGGCCATCAAGATTCGTTGTCTATCTCGAGATAGACAACGAATCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-165s21c1
Sequence:CCGGCCCATTCAGAGAAGACATCATCTCGAGATGATGTCTTCTCTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-1322s1c1
Sequence:CCGGCCATCAAGATTCGTTGTCTATCTCGAGATAGACAACGAATCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-538s1c1
Sequence:CCGGGCCATTCTGAAAGGCTGGTTTCTCGAGAAACCAGCCTTTCAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008706.1-395s1c1
Sequence:CCGGCGAAGAACTTTCAGTATCCTTCTCGAGAAGGATACTGAAAGTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-239s1c1
Sequence:CCGGCCCATTCAGAGAAGACATCATCTCGAGATGATGTCTTCTCTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-416s1c1
Sequence:CCGGCCGAGTCATCTCTAGCATATACTCGAGTATATGCTAGAGATGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-342s21c1
Sequence:CCGGCCGAGTCATCTCTAGCATATACTCGAGTATATGCTAGAGATGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-464s21c1
Sequence:CCGGGCCATTCTGAAAGGCTGGTTTCTCGAGAAACCAGCCTTTCAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008706
VALIDATED
NQO1 MISSION shRNA shRNA Plasmid DNA
NAD(P)H dehydrogenase, quinone 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008706.5-1243s21c1
Sequence:CCGGCCATCAAGATTCGTTGTCTATCTCGAGATAGACAACGAATCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-165s21c1
Sequence:CCGGCCCATTCAGAGAAGACATCATCTCGAGATGATGTCTTCTCTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-1322s1c1
Sequence:CCGGCCATCAAGATTCGTTGTCTATCTCGAGATAGACAACGAATCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-538s1c1
Sequence:CCGGGCCATTCTGAAAGGCTGGTTTCTCGAGAAACCAGCCTTTCAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008706.1-395s1c1
Sequence:CCGGCGAAGAACTTTCAGTATCCTTCTCGAGAAGGATACTGAAAGTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-239s1c1
Sequence:CCGGCCCATTCAGAGAAGACATCATCTCGAGATGATGTCTTCTCTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-416s1c1
Sequence:CCGGCCGAGTCATCTCTAGCATATACTCGAGTATATGCTAGAGATGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-342s21c1
Sequence:CCGGCCGAGTCATCTCTAGCATATACTCGAGTATATGCTAGAGATGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-464s21c1
Sequence:CCGGGCCATTCTGAAAGGCTGGTTTCTCGAGAAACCAGCCTTTCAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008706
VALIDATED
NQO1 MISSION shRNA Lentiviral Transduction Particles
NAD(P)H dehydrogenase, quinone 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008706.5-1243s21c1
Sequence:CCGGCCATCAAGATTCGTTGTCTATCTCGAGATAGACAACGAATCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-165s21c1
Sequence:CCGGCCCATTCAGAGAAGACATCATCTCGAGATGATGTCTTCTCTGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-1322s1c1
Sequence:CCGGCCATCAAGATTCGTTGTCTATCTCGAGATAGACAACGAATCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-538s1c1
Sequence:CCGGGCCATTCTGAAAGGCTGGTTTCTCGAGAAACCAGCCTTTCAGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008706.1-395s1c1
Sequence:CCGGCGAAGAACTTTCAGTATCCTTCTCGAGAAGGATACTGAAAGTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-239s1c1
Sequence:CCGGCCCATTCAGAGAAGACATCATCTCGAGATGATGTCTTCTCTGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008706.1-416s1c1
Sequence:CCGGCCGAGTCATCTCTAGCATATACTCGAGTATATGCTAGAGATGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-342s21c1
Sequence:CCGGCCGAGTCATCTCTAGCATATACTCGAGTATATGCTAGAGATGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008706.5-464s21c1
Sequence:CCGGGCCATTCTGAAAGGCTGGTTTCTCGAGAAACCAGCCTTTCAGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)