EMAIL THIS PAGE TO A FRIEND

NQO2

NAD(P)H dehydrogenase, quinone 2

56 Gene Product Result for
Synonyms: DHQV DIA6 NMOR2 QR2
UniProtKB ID: P16083, B2R492, Q5TD04
Gene ID:
Human(4835) Summary: NQO2 (EC 1.10.99.2) is a flavoprotein that catalyzes the 2-electron reduction of various quinones, redox dyes, and the vitamin K menadione. NQO2 predominantly uses dihydronicotinamide riboside (NRH) as the electron donor (summary by Wu et al., 1997 [PubMed 9367528]
Mouse(18105) NAD(P)H dehydrogenase, quinone 2
Rat(291084) NAD(P)H dehydrogenase, quinone 2
chicken(420886) NAD(P)H dehydrogenase, quinone 2
dog(606932) NAD(P)H dehydrogenase, quinone 2
cow(508566) NAD(P)H dehydrogenase, quinone 2
domestic cat(101085630) NAD(P)H dehydrogenase, quinone 2
domestic guinea pig(100715791) NAD(P)H dehydrogenase, quinone 2
naked mole-rat(101696975) NAD(P)H dehydrogenase, quinone 2
Domestic Rabbit(100301550) NAD(P)H dehydrogenase, quinone 2
sheep(101122988) NAD(P)H dehydrogenase, quinone 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000904 Rosetta Predictions human pricing
NM_001004214 Rosetta Predictions rat pricing
NM_020282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229368 predicted 735
2 SASI_Hs02_00303472 predicted 900
3 SASI_Hs01_00229369 predicted 738
4 SASI_Hs01_00229370 predicted 500
5 SASI_Hs02_00303473 predicted 339
6 SASI_Hs01_00229371 predicted 384
7 SASI_Hs01_00229373 predicted 491
8 SASI_Hs01_00229374 predicted 901
9 SASI_Hs01_00229375 predicted 515
10 SASI_Hs01_00229376 predicted 552
11 SASI_Hs01_00229372 predicted 682
12 SASI_Hs01_00229377 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198200 predicted 312
2 SASI_Rn01_00048606 predicted 863
3 SASI_Rn01_00048607 predicted 629
4 SASI_Rn01_00048608 predicted 775
5 SASI_Rn01_00048609 predicted 614
6 SASI_Rn01_00048610 predicted 821
7 SASI_Rn02_00198201 predicted 381
8 SASI_Rn02_00198202 predicted 391
9 SASI_Rn02_00198203 predicted 324
10 SASI_Rn02_00198204 predicted 219
11 SASI_Rn01_00048605 predicted 603
12 SASI_Rn01_00048611 predicted 875
13 SASI_Rn01_00048612 predicted 690
14 SASI_Rn01_00048613 predicted 825
15 SASI_Rn01_00048614 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029201 predicted 220
2 SASI_Mm01_00029202 predicted 364
3 SASI_Mm01_00029203 predicted 785
4 SASI_Mm01_00029204 predicted 583
5 SASI_Mm01_00029205 predicted 434
6 SASI_Mm01_00029206 predicted 262
7 SASI_Mm01_00029207 predicted 281
8 SASI_Mm02_00325484 predicted 489
9 SASI_Mm01_00029208 predicted 620
10 SASI_Mm01_00029209 predicted 505
11 SASI_Mm01_00029200 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000904
VALIDATED
NQO2 MISSION shRNA Bacterial Glycerol Stock
NAD(P)H dehydrogenase, quinone 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-849s21c1
Sequence:CCGGCCACTCCAGCATGGCACATTACTCGAGTAATGTGCCATGCTGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-455s1c1
Sequence:CCGGGAGGCTGACCTAGTGATATTTCTCGAGAAATATCACTAGGTCAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-330s1c1
Sequence:CCGGCAGACAAAGATATCACTGGTACTCGAGTACCAGTGATATCTTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-658s1c1
Sequence:CCGGCAATGGAGATTCTCGATACTTCTCGAGAAGTATCGAGAATCTCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-749s1c1
Sequence:CCGGGCTCCTGAAATTGCATCCGAACTCGAGTTCGGATGCAATTTCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-493s21c1
Sequence:CCGGCAGACAAAGATATCACTGGTACTCGAGTACCAGTGATATCTTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-821s21c1
Sequence:CCGGCAATGGAGATTCTCGATACTTCTCGAGAAGTATCGAGAATCTCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-741s21c1
Sequence:CCGGTCCGGTTTGCTCCAGGGTAAACTCGAGTTTACCCTGGAGCAAACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-618s21c1
Sequence:CCGGGAGGCTGACCTAGTGATATTTCTCGAGAAATATCACTAGGTCAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000904
VALIDATED
NQO2 MISSION shRNA shRNA Plasmid DNA
NAD(P)H dehydrogenase, quinone 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-849s21c1
Sequence:CCGGCCACTCCAGCATGGCACATTACTCGAGTAATGTGCCATGCTGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-455s1c1
Sequence:CCGGGAGGCTGACCTAGTGATATTTCTCGAGAAATATCACTAGGTCAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-330s1c1
Sequence:CCGGCAGACAAAGATATCACTGGTACTCGAGTACCAGTGATATCTTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-658s1c1
Sequence:CCGGCAATGGAGATTCTCGATACTTCTCGAGAAGTATCGAGAATCTCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-749s1c1
Sequence:CCGGGCTCCTGAAATTGCATCCGAACTCGAGTTCGGATGCAATTTCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-493s21c1
Sequence:CCGGCAGACAAAGATATCACTGGTACTCGAGTACCAGTGATATCTTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-821s21c1
Sequence:CCGGCAATGGAGATTCTCGATACTTCTCGAGAAGTATCGAGAATCTCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-741s21c1
Sequence:CCGGTCCGGTTTGCTCCAGGGTAAACTCGAGTTTACCCTGGAGCAAACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-618s21c1
Sequence:CCGGGAGGCTGACCTAGTGATATTTCTCGAGAAATATCACTAGGTCAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000904
VALIDATED
NQO2 MISSION shRNA Lentiviral Transduction Particles
NAD(P)H dehydrogenase, quinone 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-849s21c1
Sequence:CCGGCCACTCCAGCATGGCACATTACTCGAGTAATGTGCCATGCTGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-455s1c1
Sequence:CCGGGAGGCTGACCTAGTGATATTTCTCGAGAAATATCACTAGGTCAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-330s1c1
Sequence:CCGGCAGACAAAGATATCACTGGTACTCGAGTACCAGTGATATCTTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-658s1c1
Sequence:CCGGCAATGGAGATTCTCGATACTTCTCGAGAAGTATCGAGAATCTCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000904.1-749s1c1
Sequence:CCGGGCTCCTGAAATTGCATCCGAACTCGAGTTCGGATGCAATTTCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-493s21c1
Sequence:CCGGCAGACAAAGATATCACTGGTACTCGAGTACCAGTGATATCTTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-821s21c1
Sequence:CCGGCAATGGAGATTCTCGATACTTCTCGAGAAGTATCGAGAATCTCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-741s21c1
Sequence:CCGGTCCGGTTTGCTCCAGGGTAAACTCGAGTTTACCCTGGAGCAAACCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000904.3-618s21c1
Sequence:CCGGGAGGCTGACCTAGTGATATTTCTCGAGAAATATCACTAGGTCAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020282
VALIDATED
NQO2 MISSION shRNA Bacterial Glycerol Stock
NAD(P)H dehydrogenase, quinone 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020282.2-888s1c1
Sequence:CCGGCCCTTGGTACTTCCAAGAGTACTCGAGTACTCTTGGAAGTACCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-520s1c1
Sequence:CCGGCCACTATACTGGTTCAGCGTTCTCGAGAACGCTGAACCAGTATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-696s1c1
Sequence:CCGGCAGTGGAGATTTCCGGTACTTCTCGAGAAGTACCGGAAATCTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-406s1c1
Sequence:CCGGGTCTTCAGTTATGGGATAGAACTCGAGTTCTATCCCATAACTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020282.2-589s1c1
Sequence:CCGGGCCTTTGATATCCCAGGCTTTCTCGAGAAAGCCTGGGATATCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020282.3-1301s21c1
Sequence:CCGGATGGCCTCACCCATGGTTATGCTCGAGCATAACCATGGGTGAGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020282.2-520s21c1
Sequence:CCGGCCACTATACTGGTTCAGCGTTCTCGAGAACGCTGAACCAGTATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-450s21c1
Sequence:CCGGAGCTCTGACCAGTGATATATTCTCGAGAATATATCACTGGTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-320s21c1
Sequence:CCGGCAGTCACTGTGTCTGATTTATCTCGAGATAAATCAGACACAGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-406s21c1
Sequence:CCGGGTCTTCAGTTATGGGATAGAACTCGAGTTCTATCCCATAACTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-696s21c1
Sequence:CCGGCAGTGGAGATTTCCGGTACTTCTCGAGAAGTACCGGAAATCTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020282
VALIDATED
NQO2 MISSION shRNA shRNA Plasmid DNA
NAD(P)H dehydrogenase, quinone 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020282.2-888s1c1
Sequence:CCGGCCCTTGGTACTTCCAAGAGTACTCGAGTACTCTTGGAAGTACCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-520s1c1
Sequence:CCGGCCACTATACTGGTTCAGCGTTCTCGAGAACGCTGAACCAGTATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-696s1c1
Sequence:CCGGCAGTGGAGATTTCCGGTACTTCTCGAGAAGTACCGGAAATCTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-406s1c1
Sequence:CCGGGTCTTCAGTTATGGGATAGAACTCGAGTTCTATCCCATAACTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020282.2-589s1c1
Sequence:CCGGGCCTTTGATATCCCAGGCTTTCTCGAGAAAGCCTGGGATATCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020282.3-1301s21c1
Sequence:CCGGATGGCCTCACCCATGGTTATGCTCGAGCATAACCATGGGTGAGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020282.2-520s21c1
Sequence:CCGGCCACTATACTGGTTCAGCGTTCTCGAGAACGCTGAACCAGTATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-450s21c1
Sequence:CCGGAGCTCTGACCAGTGATATATTCTCGAGAATATATCACTGGTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-320s21c1
Sequence:CCGGCAGTCACTGTGTCTGATTTATCTCGAGATAAATCAGACACAGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-406s21c1
Sequence:CCGGGTCTTCAGTTATGGGATAGAACTCGAGTTCTATCCCATAACTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-696s21c1
Sequence:CCGGCAGTGGAGATTTCCGGTACTTCTCGAGAAGTACCGGAAATCTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020282
VALIDATED
NQO2 MISSION shRNA Lentiviral Transduction Particles
NAD(P)H dehydrogenase, quinone 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020282.2-888s1c1
Sequence:CCGGCCCTTGGTACTTCCAAGAGTACTCGAGTACTCTTGGAAGTACCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-520s1c1
Sequence:CCGGCCACTATACTGGTTCAGCGTTCTCGAGAACGCTGAACCAGTATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-696s1c1
Sequence:CCGGCAGTGGAGATTTCCGGTACTTCTCGAGAAGTACCGGAAATCTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020282.2-406s1c1
Sequence:CCGGGTCTTCAGTTATGGGATAGAACTCGAGTTCTATCCCATAACTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020282.2-589s1c1
Sequence:CCGGGCCTTTGATATCCCAGGCTTTCTCGAGAAAGCCTGGGATATCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020282.3-1301s21c1
Sequence:CCGGATGGCCTCACCCATGGTTATGCTCGAGCATAACCATGGGTGAGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020282.2-520s21c1
Sequence:CCGGCCACTATACTGGTTCAGCGTTCTCGAGAACGCTGAACCAGTATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-450s21c1
Sequence:CCGGAGCTCTGACCAGTGATATATTCTCGAGAATATATCACTGGTCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-320s21c1
Sequence:CCGGCAGTCACTGTGTCTGATTTATCTCGAGATAAATCAGACACAGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-406s21c1
Sequence:CCGGGTCTTCAGTTATGGGATAGAACTCGAGTTCTATCCCATAACTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020282.2-696s21c1
Sequence:CCGGCAGTGGAGATTTCCGGTACTTCTCGAGAAGTACCGGAAATCTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)