EMAIL THIS PAGE TO A FRIEND

NR0B1

nuclear receptor subfamily 0, group B, member 1

59 Gene Product Result for
Synonyms: AHC AHCH AHX DAX-1 DAX1 DSS GTD HHG NROB1 SRXY2
UniProtKB ID: P51843, Q96F69
Gene ID:
Human(190) Summary: This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism. [provided by RefSeq, Jul 2008]
Mouse(11614) nuclear receptor subfamily 0, group B, member 1
Rat(58850) nuclear receptor subfamily 0, group B, member 1
sheep(101113131) nuclear receptor subfamily 0, group B, member 1
Domestic Rabbit(100358557) nuclear receptor subfamily 0, group B, member 1
naked mole-rat(101720551) nuclear receptor subfamily 0, group B, member 1
domestic guinea pig(100727281) nuclear receptor subfamily 0, group B, member 1
Zebrafish(100001692) nuclear receptor subfamily 0, group B, member 1
chicken(395285) nuclear receptor subfamily 0, group B, member 1
dog(491804) nuclear receptor subfamily 0, group B, member 1
domestic cat(101100624) nuclear receptor subfamily 0, group B, member 1
cow(281949) nuclear receptor subfamily 0, group B, member 1
Horse(100033899) nuclear receptor subfamily 0, group B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500295 Anti-DAX1/NR0B1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
N7164 Anti-NR0B1 (416-430) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV48004 Anti-NR0B1 (AB1) antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, human, horse
western blot pricing
SAB2900143 Anti-NR0B1 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB2900144 Anti-NR0B1 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
HPA061948 Anti-NR0B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA067207 Anti-NR0B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA070839 Anti-NR0B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1403533 Monoclonal Anti-NR0B1, (C-terminal) antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1402110 Monoclonal Anti-NR0B1, (C-terminal) antibody produced in mouse clone 1F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000475 Rosetta Predictions human pricing
NM_053317 Rosetta Predictions rat pricing
NM_007430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164534 predicted 450
2 SASI_Hs01_00164535 predicted 432
3 SASI_Hs01_00164536 predicted 257
4 SASI_Hs01_00164537 predicted 1114
5 SASI_Hs01_00164538 predicted 915
6 SASI_Hs01_00164540 predicted 451
7 SASI_Hs01_00164541 predicted 446
8 SASI_Hs01_00164542 predicted 1124
9 SASI_Hs01_00164543 predicted 322
10 SASI_Hs02_00302613 predicted 385
11 SASI_Hs01_00164539 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092535 predicted 1482
2 SASI_Rn01_00092536 predicted 1334
3 SASI_Rn01_00092537 predicted 1478
4 SASI_Rn02_00265743 predicted 666
5 SASI_Rn01_00092538 predicted 1237
6 SASI_Rn01_00092539 predicted 1329
7 SASI_Rn01_00092540 predicted 1527
8 SASI_Rn01_00092542 predicted 1031
9 SASI_Rn01_00092543 predicted 1278
10 SASI_Rn02_00265744 predicted 897
11 SASI_Rn01_00092541 predicted 963
12 SASI_Rn01_00092544 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189119 predicted 1345
2 SASI_Mm01_00189120 predicted 1280
3 SASI_Mm01_00189121 predicted 1326
4 SASI_Mm02_00311587 predicted 1431
5 SASI_Mm01_00189122 predicted 475
6 SASI_Mm01_00189124 predicted 547
7 SASI_Mm01_00189125 predicted 1145
8 SASI_Mm01_00189127 predicted 1443
9 SASI_Mm02_00311588 predicted 1485
10 SASI_Mm01_00189128 predicted 612
11 SASI_Mm01_00189123 predicted 1354
12 SASI_Mm01_00189126 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000475
NR0B1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 0, group B, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-661s21c1
Sequence:CCGGGTGCCCACGAGCACAAATCAACTCGAGTTGATTTGTGCTCGTGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-1196s21c1
Sequence:CCGGTGCAGTGCGTGAAGTACATTCCTCGAGGAATGTACTTCACGCACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-33s1c1
Sequence:CCGGCATCCTCTACAACATGCTTATCTCGAGATAAGCATGTTGTAGAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1386s1c1
Sequence:CCGGGCTGGAAATGCTCTGTACAAACTCGAGTTTGTACAGAGCATTTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1267s1c1
Sequence:CCGGCATGACAGATTCATCGAACTTCTCGAGAAGTTCGATGAATCTGTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1305s1c1
Sequence:CCGGGCTGAGATTCATCAATGCCAACTCGAGTTGGCATTGATGAATCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1075s1c1
Sequence:CCGGCAAGCCATCAAGTGCTTTCTTCTCGAGAAGAAAGCACTTGATGGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-1378s21c1
Sequence:CCGGACAGTCAGCATGGATGATATGCTCGAGCATATCATCCATGCTGACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-812s21c1
Sequence:CCGGTGCGCTTCGTCAAGTACTTGCCTCGAGGCAAGTACTTGACGAAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000475
NR0B1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 0, group B, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-661s21c1
Sequence:CCGGGTGCCCACGAGCACAAATCAACTCGAGTTGATTTGTGCTCGTGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-1196s21c1
Sequence:CCGGTGCAGTGCGTGAAGTACATTCCTCGAGGAATGTACTTCACGCACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-33s1c1
Sequence:CCGGCATCCTCTACAACATGCTTATCTCGAGATAAGCATGTTGTAGAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1386s1c1
Sequence:CCGGGCTGGAAATGCTCTGTACAAACTCGAGTTTGTACAGAGCATTTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1267s1c1
Sequence:CCGGCATGACAGATTCATCGAACTTCTCGAGAAGTTCGATGAATCTGTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1305s1c1
Sequence:CCGGGCTGAGATTCATCAATGCCAACTCGAGTTGGCATTGATGAATCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1075s1c1
Sequence:CCGGCAAGCCATCAAGTGCTTTCTTCTCGAGAAGAAAGCACTTGATGGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-1378s21c1
Sequence:CCGGACAGTCAGCATGGATGATATGCTCGAGCATATCATCCATGCTGACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-812s21c1
Sequence:CCGGTGCGCTTCGTCAAGTACTTGCCTCGAGGCAAGTACTTGACGAAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000475
NR0B1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 0, group B, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-661s21c1
Sequence:CCGGGTGCCCACGAGCACAAATCAACTCGAGTTGATTTGTGCTCGTGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-1196s21c1
Sequence:CCGGTGCAGTGCGTGAAGTACATTCCTCGAGGAATGTACTTCACGCACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-33s1c1
Sequence:CCGGCATCCTCTACAACATGCTTATCTCGAGATAAGCATGTTGTAGAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1386s1c1
Sequence:CCGGGCTGGAAATGCTCTGTACAAACTCGAGTTTGTACAGAGCATTTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1267s1c1
Sequence:CCGGCATGACAGATTCATCGAACTTCTCGAGAAGTTCGATGAATCTGTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1305s1c1
Sequence:CCGGGCTGAGATTCATCAATGCCAACTCGAGTTGGCATTGATGAATCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000475.2-1075s1c1
Sequence:CCGGCAAGCCATCAAGTGCTTTCTTCTCGAGAAGAAAGCACTTGATGGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-1378s21c1
Sequence:CCGGACAGTCAGCATGGATGATATGCTCGAGCATATCATCCATGCTGACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000475.4-812s21c1
Sequence:CCGGTGCGCTTCGTCAAGTACTTGCCTCGAGGCAAGTACTTGACGAAGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007430
NR0B1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 0, group B, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007430.4-255s21c1
Sequence:CCGGGGTGGCATCCTCTACTCTATGCTCGAGCATAGAGTAGAGGATGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-623s1c1
Sequence:CCGGCGCAGCTATGTGTGCGGTGAACTCGAGTTCACCGCACACATAGCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-1255s1c1
Sequence:CCGGGCAGATCCTTACTGAGCACATCTCGAGATGTGCTCAGTAAGGATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007430.1-1624s1c1
Sequence:CCGGGCTTCTTGTGAAGGAAAGCATCTCGAGATGCTTTCCTTCACAAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-58s1c1
Sequence:CCGGCATCCTCTACAATCTACTGATCTCGAGATCAGTAGATTGTAGAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-1105s1c1
Sequence:CCGGCCAGGCCATCAAGAGTTTCTTCTCGAGAAGAAACTCTTGATGGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007430.4-1175s21c1
Sequence:CCGGGAAAGGGACCGTGCTCTTTAACTCGAGTTAAAGAGCACGGTCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007430.4-1451s21c1
Sequence:CCGGTATGTCCACTCAAGTGCATTTCTCGAGAAATGCACTTGAGTGGACATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007430.4-1500s21c1
Sequence:CCGGTGTAGGCAGAAGAGTGCTAAACTCGAGTTTAGCACTCTTCTGCCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007430
NR0B1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 0, group B, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007430.4-255s21c1
Sequence:CCGGGGTGGCATCCTCTACTCTATGCTCGAGCATAGAGTAGAGGATGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-623s1c1
Sequence:CCGGCGCAGCTATGTGTGCGGTGAACTCGAGTTCACCGCACACATAGCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-1255s1c1
Sequence:CCGGGCAGATCCTTACTGAGCACATCTCGAGATGTGCTCAGTAAGGATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007430.1-1624s1c1
Sequence:CCGGGCTTCTTGTGAAGGAAAGCATCTCGAGATGCTTTCCTTCACAAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-58s1c1
Sequence:CCGGCATCCTCTACAATCTACTGATCTCGAGATCAGTAGATTGTAGAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-1105s1c1
Sequence:CCGGCCAGGCCATCAAGAGTTTCTTCTCGAGAAGAAACTCTTGATGGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007430.4-1175s21c1
Sequence:CCGGGAAAGGGACCGTGCTCTTTAACTCGAGTTAAAGAGCACGGTCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007430.4-1451s21c1
Sequence:CCGGTATGTCCACTCAAGTGCATTTCTCGAGAAATGCACTTGAGTGGACATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007430.4-1500s21c1
Sequence:CCGGTGTAGGCAGAAGAGTGCTAAACTCGAGTTTAGCACTCTTCTGCCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007430
NR0B1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 0, group B, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007430.4-255s21c1
Sequence:CCGGGGTGGCATCCTCTACTCTATGCTCGAGCATAGAGTAGAGGATGCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-623s1c1
Sequence:CCGGCGCAGCTATGTGTGCGGTGAACTCGAGTTCACCGCACACATAGCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-1255s1c1
Sequence:CCGGGCAGATCCTTACTGAGCACATCTCGAGATGTGCTCAGTAAGGATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007430.1-1624s1c1
Sequence:CCGGGCTTCTTGTGAAGGAAAGCATCTCGAGATGCTTTCCTTCACAAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-58s1c1
Sequence:CCGGCATCCTCTACAATCTACTGATCTCGAGATCAGTAGATTGTAGAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007430.1-1105s1c1
Sequence:CCGGCCAGGCCATCAAGAGTTTCTTCTCGAGAAGAAACTCTTGATGGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007430.4-1175s21c1
Sequence:CCGGGAAAGGGACCGTGCTCTTTAACTCGAGTTAAAGAGCACGGTCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007430.4-1451s21c1
Sequence:CCGGTATGTCCACTCAAGTGCATTTCTCGAGAAATGCACTTGAGTGGACATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007430.4-1500s21c1
Sequence:CCGGTGTAGGCAGAAGAGTGCTAAACTCGAGTTTAGCACTCTTCTGCCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)