EMAIL THIS PAGE TO A FRIEND

NR1D1

nuclear receptor subfamily 1, group D, member 1

89 Gene Product Result for
Synonyms: EAR1 THRA1 THRAL ear-1 hRev
UniProtKB ID: P20393, Q0P5Z4, Q15304
Gene ID:
Human(9572) Summary: This gene encodes a transcription factor that is a member of the nuclear receptor subfamily 1. The encoded protein is a ligand-sensitive transcription factor that negatively regulates the expression of core clock proteins. In particular this protein represses the circadian clock transcription factor aryl hydrocarbon receptor nuclear translocator-like protein 1 (ARNTL). This protein may also be involved in regulating genes that function in metabolic, inflammatory and cardiovascular processes. [provided by RefSeq, Jan 2013]
Mouse(217166) nuclear receptor subfamily 1, group D, member 1
Rat(252917) nuclear receptor subfamily 1, group D, member 1
Zebrafish(494487) nuclear receptor subfamily 1, group d, member 1
domestic cat(101094802) nuclear receptor subfamily 1, group D, member 1
cow(768225) nuclear receptor subfamily 1, group D, member 1
dog(100688236) nuclear receptor subfamily 1, group D, member 1
sheep(100174903) nuclear receptor subfamily 1, group D, member 1
naked mole-rat(101696811) nuclear receptor subfamily 1, group D, member 1
Domestic Rabbit(100357678) nuclear receptor subfamily 1, group D, member 1
domestic guinea pig(100726463) nuclear receptor subfamily 1, group D, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021724 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021724 Rosetta Predictions human pricing
NM_001113422 Rosetta Predictions rat pricing
NM_145775 Rosetta Predictions rat pricing
NM_145434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041832 predicted 2033
2 SASI_Hs01_00041833 predicted 1674
3 SASI_Hs01_00041834 predicted 2195
4 SASI_Hs01_00041835 predicted 2107
5 SASI_Hs01_00041836 predicted 2099
6 SASI_Hs01_00041837 predicted 2070
7 SASI_Hs01_00041838 predicted 1926
8 SASI_Hs01_00041839 predicted 1657
9 SASI_Hs02_00355043 predicted 2005
10 SASI_Hs01_00041840 predicted 2145
11 SASI_Hs01_00041841 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251833 predicted 1689
2 SASI_Rn02_00251834 predicted 1618
3 SASI_Rn02_00251835 predicted 1255
4 SASI_Rn02_00251836 predicted 862
5 SASI_Rn02_00251837 predicted 1633
6 SASI_Rn02_00251838 predicted 1269
7 SASI_Rn02_00251839 predicted 510
8 SASI_Rn02_00251840 predicted 1764
9 SASI_Rn02_00251841 predicted 571
10 SASI_Rn02_00251842 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077825 predicted 1657
2 SASI_Rn01_00077826 predicted 1593
3 SASI_Rn02_00268776 predicted 843
4 SASI_Rn01_00077828 predicted 1231
5 SASI_Rn01_00077829 predicted 830
6 SASI_Rn01_00077830 predicted 1605
7 SASI_Rn01_00077831 predicted 1239
8 SASI_Rn01_00077832 predicted 1733
9 SASI_Rn01_00077833 predicted 541
10 SASI_Rn01_00077834 predicted 813
11 SASI_Rn01_00077827 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116940 predicted 1970
2 SASI_Mm01_00116941 predicted 621
3 SASI_Mm01_00116942 predicted 1904
4 SASI_Mm01_00116943 predicted 1158
5 SASI_Mm01_00116944 predicted 2230
6 SASI_Mm01_00116946 predicted 633
7 SASI_Mm01_00116947 predicted 1541
8 SASI_Mm01_00116948 predicted 2050
9 SASI_Mm01_00116949 predicted 868
10 SASI_Mm02_00340804 predicted 1905
11 SASI_Mm01_00116945 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021724
VALIDATED
NR1D1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 1, group D, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-2177s21c1
Sequence:CCGGCAGTGCCATGTTCGACTTCAGCTCGAGCTGAAGTCGAACATGGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-721s21c1
Sequence:CCGGTCTATAGTGACAACTCCAATGCTCGAGCATTGGAGTTGTCACTATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021724.2-2500s21c1
Sequence:CCGGCCCTTGTACAGAATCGAACTCCTCGAGGAGTTCGATTCTGTACAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-1147s21c1
Sequence:CCGGATTGCTCCATCGTCCGCATCACTCGAGTGATGCGGACGATGGAGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021724.1-1675s1c1
Sequence:CCGGCGTCATAACGAGGCCCTAAATCTCGAGATTTAGGGCCTCGTTATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-707s1c1
Sequence:CCGGCCAGCCCTGAATCCCTCTATACTCGAGTATAGAGGGATTCAGGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-2073s1c1
Sequence:CCGGGCGCTTTGCTTCGTTGTTCAACTCGAGTTGAACAACGAAGCAAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021724.1-1872s1c1
Sequence:CCGGGCTGGCATGTCCTATGAACATCTCGAGATGTTCATAGGACATGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-1107s1c1
Sequence:CCGGCCAGCAGAACATCCAGTACAACTCGAGTTGTACTGGATGTTCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-1520s21c1
Sequence:CCGGGATCTTCACCTACGCCCATGACTCGAGTCATGGGCGTAGGTGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021724
VALIDATED
NR1D1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 1, group D, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-2177s21c1
Sequence:CCGGCAGTGCCATGTTCGACTTCAGCTCGAGCTGAAGTCGAACATGGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-721s21c1
Sequence:CCGGTCTATAGTGACAACTCCAATGCTCGAGCATTGGAGTTGTCACTATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021724.2-2500s21c1
Sequence:CCGGCCCTTGTACAGAATCGAACTCCTCGAGGAGTTCGATTCTGTACAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-1147s21c1
Sequence:CCGGATTGCTCCATCGTCCGCATCACTCGAGTGATGCGGACGATGGAGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021724.1-1675s1c1
Sequence:CCGGCGTCATAACGAGGCCCTAAATCTCGAGATTTAGGGCCTCGTTATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-707s1c1
Sequence:CCGGCCAGCCCTGAATCCCTCTATACTCGAGTATAGAGGGATTCAGGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-2073s1c1
Sequence:CCGGGCGCTTTGCTTCGTTGTTCAACTCGAGTTGAACAACGAAGCAAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021724.1-1872s1c1
Sequence:CCGGGCTGGCATGTCCTATGAACATCTCGAGATGTTCATAGGACATGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-1107s1c1
Sequence:CCGGCCAGCAGAACATCCAGTACAACTCGAGTTGTACTGGATGTTCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-1520s21c1
Sequence:CCGGGATCTTCACCTACGCCCATGACTCGAGTCATGGGCGTAGGTGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021724
VALIDATED
NR1D1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 1, group D, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-2177s21c1
Sequence:CCGGCAGTGCCATGTTCGACTTCAGCTCGAGCTGAAGTCGAACATGGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-721s21c1
Sequence:CCGGTCTATAGTGACAACTCCAATGCTCGAGCATTGGAGTTGTCACTATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021724.2-2500s21c1
Sequence:CCGGCCCTTGTACAGAATCGAACTCCTCGAGGAGTTCGATTCTGTACAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-1147s21c1
Sequence:CCGGATTGCTCCATCGTCCGCATCACTCGAGTGATGCGGACGATGGAGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021724.1-1675s1c1
Sequence:CCGGCGTCATAACGAGGCCCTAAATCTCGAGATTTAGGGCCTCGTTATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-707s1c1
Sequence:CCGGCCAGCCCTGAATCCCTCTATACTCGAGTATAGAGGGATTCAGGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-2073s1c1
Sequence:CCGGGCGCTTTGCTTCGTTGTTCAACTCGAGTTGAACAACGAAGCAAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021724.1-1872s1c1
Sequence:CCGGGCTGGCATGTCCTATGAACATCTCGAGATGTTCATAGGACATGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021724.1-1107s1c1
Sequence:CCGGCCAGCAGAACATCCAGTACAACTCGAGTTGTACTGGATGTTCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021724.2-1520s21c1
Sequence:CCGGGATCTTCACCTACGCCCATGACTCGAGTCATGGGCGTAGGTGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145434
NR1D1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 1, group D, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-962s1c1
Sequence:CCGGCCATCGAGAAATCTTCACCTACTCGAGTAGGTGAAGATTTCTCGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1523s1c1
Sequence:CCGGGCGCTTTGCATCGTTGTTCAACTCGAGTTGAACAACGATGCAAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1125s1c1
Sequence:CCGGCGTCATAATGAAGCGCTGAATCTCGAGATTCAGCGCTTCATTATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-569s1c1
Sequence:CCGGCCAGTACAAACGGTGTCTGAACTCGAGTTCAGACACCGTTTGTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1008s1c1
Sequence:CCGGCCTGGTAACTTCAATGCCAATCTCGAGATTGGCATTGAAGTTACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145434
NR1D1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 1, group D, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-962s1c1
Sequence:CCGGCCATCGAGAAATCTTCACCTACTCGAGTAGGTGAAGATTTCTCGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1523s1c1
Sequence:CCGGGCGCTTTGCATCGTTGTTCAACTCGAGTTGAACAACGATGCAAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1125s1c1
Sequence:CCGGCGTCATAATGAAGCGCTGAATCTCGAGATTCAGCGCTTCATTATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-569s1c1
Sequence:CCGGCCAGTACAAACGGTGTCTGAACTCGAGTTCAGACACCGTTTGTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1008s1c1
Sequence:CCGGCCTGGTAACTTCAATGCCAATCTCGAGATTGGCATTGAAGTTACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145434
NR1D1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 1, group D, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-962s1c1
Sequence:CCGGCCATCGAGAAATCTTCACCTACTCGAGTAGGTGAAGATTTCTCGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1523s1c1
Sequence:CCGGGCGCTTTGCATCGTTGTTCAACTCGAGTTGAACAACGATGCAAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1125s1c1
Sequence:CCGGCGTCATAATGAAGCGCTGAATCTCGAGATTCAGCGCTTCATTATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-569s1c1
Sequence:CCGGCCAGTACAAACGGTGTCTGAACTCGAGTTCAGACACCGTTTGTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145434.1-1008s1c1
Sequence:CCGGCCTGGTAACTTCAATGCCAATCTCGAGATTGGCATTGAAGTTACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)