EMAIL THIS PAGE TO A FRIEND

NR1H3

nuclear receptor subfamily 1, group H, member 3

56 Gene Product Result for
Synonyms: LXR-a LXRA RLD-1
UniProtKB ID: Q13133, A8K3J9, D3DQR1, Q8IW13, Q96H87
Gene ID:
Human(10062) Summary: The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(22259) nuclear receptor subfamily 1, group H, member 3
Rat(58852) nuclear receptor subfamily 1, group H, member 3
Goat(100860906) nuclear receptor subfamily 1, group H, member 3
sheep(101116762) nuclear receptor subfamily 1, group H, member 3
domestic guinea pig(100725013) nuclear receptor subfamily 1, group H, member 3
naked mole-rat(101709627) nuclear receptor subfamily 1, group H, member 3
Zebrafish(548341) nuclear receptor subfamily 1, group H, member 3
cow(507176) nuclear receptor subfamily 1, group H, member 3
domestic cat(101092889) nuclear receptor subfamily 1, group H, member 3
dog(483625) nuclear receptor subfamily 1, group H, member 3
chicken(395221) nuclear receptor subfamily 1, group H, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
H3878 Hyodeoxycholic acid ≥98% human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
T2320 T0901317 ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005693 siRNAs that have been validated in the lab human pricing
NM_031627 Rosetta Predictions rat pricing
NM_013839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005693 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207733 validated 1092
1 SASI_Hs01_00207735 validated 585
2 SASI_Hs01_00207734 predicted 1063
3 SASI_Hs01_00207736 predicted 260
4 SASI_Hs01_00207737 predicted 908
5 SASI_Hs01_00207738 predicted 699
6 SASI_Hs01_00207739 predicted 945
7 SASI_Hs01_00207741 predicted 835
8 SASI_Hs01_00207742 predicted 479
9 SASI_Hs02_00340095 predicted 1025
10 SASI_Hs01_00207740 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032591 predicted 1268
2 SASI_Rn01_00032592 predicted 1045
3 SASI_Rn01_00032594 predicted 923
4 SASI_Rn01_00032595 predicted 1207
5 SASI_Rn01_00032596 predicted 1040
6 SASI_Rn01_00032597 predicted 1249
7 SASI_Rn01_00032598 predicted 515
8 SASI_Rn01_00032599 predicted 636
9 SASI_Rn01_00032600 predicted 906
10 SASI_Rn02_00264932 predicted 1063
11 SASI_Rn01_00032593 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189869 predicted 1366
2 SASI_Mm01_00189870 predicted 840
3 SASI_Mm01_00189871 predicted 1076
4 SASI_Mm01_00189872 predicted 776
5 SASI_Mm01_00189873 predicted 1541
6 SASI_Mm02_00322837 predicted 861
7 SASI_Mm01_00189875 predicted 354
8 SASI_Mm01_00189876 predicted 1671
9 SASI_Mm01_00189877 predicted 709
10 SASI_Mm01_00189878 predicted 844
11 SASI_Mm01_00189874 predicted 1389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005693
NR1H3 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 1, group H, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005693.2-1243s21c1
Sequence:CCGGAGTTCTCCAGGGCCATGAATGCTCGAGCATTCATGGCCCTGGAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005693.2-1544s21c1
Sequence:CCGGGATCTGGGATGTGCACGAATGCTCGAGCATTCGTGCACATCCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-976s1c1
Sequence:CCGGCCTTCCTCAAGGATTTCAGTTCTCGAGAACTGAAATCCTTGAGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-1235s1c1
Sequence:CCGGCCGACTGATGTTCCCACGGATCTCGAGATCCGTGGGAACATCAGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-828s1c1
Sequence:CCGGGTGCAGGAGATAGTTGACTTTCTCGAGAAAGTCAACTATCTCCTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-561s1c1
Sequence:CCGGCTGAAGAAACTGAAGCGGCAACTCGAGTTGCCGCTTCAGTTTCTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-1082s1c1
Sequence:CCGGGCAACTCAATGATGCCGAGTTCTCGAGAACTCGGCATCATTGAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005693
NR1H3 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 1, group H, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005693.2-1243s21c1
Sequence:CCGGAGTTCTCCAGGGCCATGAATGCTCGAGCATTCATGGCCCTGGAGAACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000438442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005693.2-1544s21c1
Sequence:CCGGGATCTGGGATGTGCACGAATGCTCGAGCATTCGTGCACATCCCAGATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-976s1c1
Sequence:CCGGCCTTCCTCAAGGATTTCAGTTCTCGAGAACTGAAATCCTTGAGGAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-1235s1c1
Sequence:CCGGCCGACTGATGTTCCCACGGATCTCGAGATCCGTGGGAACATCAGTCGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-828s1c1
Sequence:CCGGGTGCAGGAGATAGTTGACTTTCTCGAGAAAGTCAACTATCTCCTGCACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-561s1c1
Sequence:CCGGCTGAAGAAACTGAAGCGGCAACTCGAGTTGCCGCTTCAGTTTCTTCAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-1082s1c1
Sequence:CCGGGCAACTCAATGATGCCGAGTTCTCGAGAACTCGGCATCATTGAGTTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005693
NR1H3 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 1, group H, member 3
Human
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000438551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005693.2-1243s21c1
Sequence:CCGGAGTTCTCCAGGGCCATGAATGCTCGAGCATTCATGGCCCTGGAGAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005693.2-1544s21c1
Sequence:CCGGGATCTGGGATGTGCACGAATGCTCGAGCATTCGTGCACATCCCAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-976s1c1
Sequence:CCGGCCTTCCTCAAGGATTTCAGTTCTCGAGAACTGAAATCCTTGAGGAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-1235s1c1
Sequence:CCGGCCGACTGATGTTCCCACGGATCTCGAGATCCGTGGGAACATCAGTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-828s1c1
Sequence:CCGGGTGCAGGAGATAGTTGACTTTCTCGAGAAAGTCAACTATCTCCTGCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-561s1c1
Sequence:CCGGCTGAAGAAACTGAAGCGGCAACTCGAGTTGCCGCTTCAGTTTCTTCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005693.1-1082s1c1
Sequence:CCGGGCAACTCAATGATGCCGAGTTCTCGAGAACTCGGCATCATTGAGTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013839
NR1H3 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 1, group H, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-702s1c1
Sequence:CCGGGATCCGCTTGAAGAAACTGAACTCGAGTTCAGTTTCTTCAAGCGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1128s1c1
Sequence:CCGGCCTCAAGGACTTCAGTTACAACTCGAGTTGTAACTGAAGTCCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1440s1c1
Sequence:CCGGCGTCCATTCAGAGCAAGTGTTCTCGAGAACACTTGCTCTGAATGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1230s1c1
Sequence:CCGGGCAACTCAATGATGCTGAGTTCTCGAGAACTCAGCATCATTGAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-975s1c1
Sequence:CCGGCGTGCAGGAGATTGTTGACTTCTCGAGAAGTCAACAATCTCCTGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013839
NR1H3 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 1, group H, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-702s1c1
Sequence:CCGGGATCCGCTTGAAGAAACTGAACTCGAGTTCAGTTTCTTCAAGCGGATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1128s1c1
Sequence:CCGGCCTCAAGGACTTCAGTTACAACTCGAGTTGTAACTGAAGTCCTTGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1440s1c1
Sequence:CCGGCGTCCATTCAGAGCAAGTGTTCTCGAGAACACTTGCTCTGAATGGACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1230s1c1
Sequence:CCGGGCAACTCAATGATGCTGAGTTCTCGAGAACTCAGCATCATTGAGTTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-975s1c1
Sequence:CCGGCGTGCAGGAGATTGTTGACTTCTCGAGAAGTCAACAATCTCCTGCACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013839
NR1H3 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 1, group H, member 3
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000026023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-702s1c1
Sequence:CCGGGATCCGCTTGAAGAAACTGAACTCGAGTTCAGTTTCTTCAAGCGGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1128s1c1
Sequence:CCGGCCTCAAGGACTTCAGTTACAACTCGAGTTGTAACTGAAGTCCTTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1440s1c1
Sequence:CCGGCGTCCATTCAGAGCAAGTGTTCTCGAGAACACTTGCTCTGAATGGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-1230s1c1
Sequence:CCGGGCAACTCAATGATGCTGAGTTCTCGAGAACTCAGCATCATTGAGTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013839.1-975s1c1
Sequence:CCGGCGTGCAGGAGATTGTTGACTTCTCGAGAAGTCAACAATCTCCTGCACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)