EMAIL THIS PAGE TO A FRIEND

NR1H4

nuclear receptor subfamily 1, group H, member 4

72 Gene Product Result for
Synonyms: BAR FXR HRR-1 HRR1 RIP14
Gene ID:
Human(9971) Summary: This gene encodes a ligand-activated transcription factor, which shares structural features in common with nuclear hormone receptor family, such as a DNA-binding domain that targets the receptor to specific DNA sequences, and a ligand-binding domain, which interacts directly with the ligand and contains a ligand-dependent transcriptional activation domain. This protein functions as a receptor for bile acids, and when bound to bile acids, regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(20186) nuclear receptor subfamily 1, group H, member 4
Rat(60351) nuclear receptor subfamily 1, group H, member 4
Zebrafish(436847) nuclear receptor subfamily 1, group H, member 4
chicken(373902) nuclear receptor subfamily 1, group H, member 4
cow(540528) nuclear receptor subfamily 1, group H, member 4
Horse(100052821) nuclear receptor subfamily 1, group H, member 4
domestic cat(101096997) nuclear receptor subfamily 1, group H, member 4
dog(612928) nuclear receptor subfamily 1, group H, member 4
naked mole-rat(101714263) nuclear receptor subfamily 1, group H, member 4
Domestic Rabbit(100009485) nuclear receptor subfamily 1, group H, member 4
domestic guinea pig(100734377) nuclear receptor subfamily 1, group H, member 4
sheep(101105401) nuclear receptor subfamily 1, group H, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005123 Rosetta Predictions human pricing
NM_021745 Rosetta Predictions rat pricing
NM_009108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198309 predicted 1275
2 SASI_Hs01_00198310 predicted 1545
3 SASI_Hs02_00339033 predicted 519
4 SASI_Hs01_00198311 predicted 1484
5 SASI_Hs01_00198312 predicted 874
6 SASI_Hs01_00198313 predicted 1711
7 SASI_Hs02_00339034 predicted 1816
8 SASI_Hs01_00198314 predicted 513
9 SASI_Hs01_00198315 predicted 1692
10 SASI_Hs01_00198318 predicted 1218
11 SASI_Hs01_00198316 predicted 1810
12 SASI_Hs01_00198317 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103730 predicted 929
2 SASI_Rn01_00103731 predicted 1351
3 SASI_Rn01_00103732 predicted 918
4 SASI_Rn01_00103734 predicted 1040
5 SASI_Rn01_00103735 predicted 727
6 SASI_Rn01_00103736 predicted 1629
7 SASI_Rn01_00103737 predicted 843
8 SASI_Rn01_00103738 predicted 1341
9 SASI_Rn01_00103739 predicted 740
10 SASI_Rn02_00262782 predicted 307
11 SASI_Rn01_00103733 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102935 predicted 1132
2 SASI_Mm01_00102936 predicted 1528
3 SASI_Mm01_00102938 predicted 592
4 SASI_Mm01_00102939 predicted 924
5 SASI_Mm01_00102940 predicted 209
6 SASI_Mm01_00102941 predicted 1112
7 SASI_Mm01_00102942 predicted 1397
8 SASI_Mm01_00102943 predicted 1107
9 SASI_Mm02_00315368 predicted 1508
10 SASI_Mm01_00102944 predicted 1404
11 SASI_Mm01_00102937 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009108
VALIDATED
NR1H4 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 1, group H, member 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-183s1c1
Sequence:CCGGCCATACAACAATGTCCCGTTTCTCGAGAAACGGGACATTGTTGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-983s1c1
Sequence:CCGGCCACGAAGATCAGATTGCTTTCTCGAGAAAGCAATCTGATCTTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009108.1-518s1c1
Sequence:CCGGCGCCGTGTACAAGTGTAAGAACTCGAGTTCTTACACTTGTACACGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-1397s1c1
Sequence:CCGGGCTGATGTCTTGGAGAGTGAACTCGAGTTCACTCTCCAAGACATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009108.1-1136s1c1
Sequence:CCGGCCCGATGTTCAGTTTCTATAACTCGAGTTATAGAAACTGAACATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.2-873s21c1
Sequence:CCGGGCCTCAGGAAATCACAAATAACTCGAGTTATTTGTGATTTCCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009108.2-1557s21c1
Sequence:CCGGACCTGGTTTCACTCAAGAATCCTCGAGGATTCTTGAGTGAAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009108.1-223s21c1
Sequence:CCGGTTTCCTCCTCGTCTTACTATTCTCGAGAATAGTAAGACGAGGAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-1033s21c1
Sequence:CCGGTTCTTCGTTCGGCGGAGATTTCTCGAGAAATCTCCGCCGAACGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009108.1-1572s21c1
Sequence:CCGGTACACCTCCCACGGTTGTAAACTCGAGTTTACAACCGTGGGAGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-1113s21c1
Sequence:CCGGGGTATCTCTGATGAGTATATACTCGAGTATATACTCATCAGAGATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-795s21c1
Sequence:CCGGCAGACCCTCCTGGATTATATTCTCGAGAATATAATCCAGGAGGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009108
VALIDATED
NR1H4 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 1, group H, member 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-183s1c1
Sequence:CCGGCCATACAACAATGTCCCGTTTCTCGAGAAACGGGACATTGTTGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-983s1c1
Sequence:CCGGCCACGAAGATCAGATTGCTTTCTCGAGAAAGCAATCTGATCTTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009108.1-518s1c1
Sequence:CCGGCGCCGTGTACAAGTGTAAGAACTCGAGTTCTTACACTTGTACACGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-1397s1c1
Sequence:CCGGGCTGATGTCTTGGAGAGTGAACTCGAGTTCACTCTCCAAGACATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009108.1-1136s1c1
Sequence:CCGGCCCGATGTTCAGTTTCTATAACTCGAGTTATAGAAACTGAACATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.2-873s21c1
Sequence:CCGGGCCTCAGGAAATCACAAATAACTCGAGTTATTTGTGATTTCCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009108.2-1557s21c1
Sequence:CCGGACCTGGTTTCACTCAAGAATCCTCGAGGATTCTTGAGTGAAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009108.1-223s21c1
Sequence:CCGGTTTCCTCCTCGTCTTACTATTCTCGAGAATAGTAAGACGAGGAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-1033s21c1
Sequence:CCGGTTCTTCGTTCGGCGGAGATTTCTCGAGAAATCTCCGCCGAACGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009108.1-1572s21c1
Sequence:CCGGTACACCTCCCACGGTTGTAAACTCGAGTTTACAACCGTGGGAGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-1113s21c1
Sequence:CCGGGGTATCTCTGATGAGTATATACTCGAGTATATACTCATCAGAGATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-795s21c1
Sequence:CCGGCAGACCCTCCTGGATTATATTCTCGAGAATATAATCCAGGAGGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009108
VALIDATED
NR1H4 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 1, group H, member 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-183s1c1
Sequence:CCGGCCATACAACAATGTCCCGTTTCTCGAGAAACGGGACATTGTTGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-983s1c1
Sequence:CCGGCCACGAAGATCAGATTGCTTTCTCGAGAAAGCAATCTGATCTTCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009108.1-518s1c1
Sequence:CCGGCGCCGTGTACAAGTGTAAGAACTCGAGTTCTTACACTTGTACACGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009108.1-1397s1c1
Sequence:CCGGGCTGATGTCTTGGAGAGTGAACTCGAGTTCACTCTCCAAGACATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009108.1-1136s1c1
Sequence:CCGGCCCGATGTTCAGTTTCTATAACTCGAGTTATAGAAACTGAACATCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.2-873s21c1
Sequence:CCGGGCCTCAGGAAATCACAAATAACTCGAGTTATTTGTGATTTCCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009108.2-1557s21c1
Sequence:CCGGACCTGGTTTCACTCAAGAATCCTCGAGGATTCTTGAGTGAAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009108.1-223s21c1
Sequence:CCGGTTTCCTCCTCGTCTTACTATTCTCGAGAATAGTAAGACGAGGAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-1033s21c1
Sequence:CCGGTTCTTCGTTCGGCGGAGATTTCTCGAGAAATCTCCGCCGAACGAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009108.1-1572s21c1
Sequence:CCGGTACACCTCCCACGGTTGTAAACTCGAGTTTACAACCGTGGGAGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-1113s21c1
Sequence:CCGGGGTATCTCTGATGAGTATATACTCGAGTATATACTCATCAGAGATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009108.1-795s21c1
Sequence:CCGGCAGACCCTCCTGGATTATATTCTCGAGAATATAATCCAGGAGGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005123
NR1H4 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 1, group H, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1581s1c1
Sequence:CCGGCCACTTCTTGATGTGCTACAACTCGAGTTGTAGCACATCAAGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-753s1c1
Sequence:CCGGGCCTCTGGATACCACTATAATCTCGAGATTATAGTGGTATCCAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1660s1c1
Sequence:CCGGGCCTGACTGAATTACGGACATCTCGAGATGTCCGTAATTCAGTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1148s1c1
Sequence:CCGGGCCTCAGGAAATAACAAATAACTCGAGTTATTTGTTATTTCCTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-517s1c1
Sequence:CCGGCCCAAGTTCAACCACAGATTTCTCGAGAAATCTGTGGTTGAACTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-923s21c1
Sequence:CCGGTGTTGGCTGAATGCTTGTTAACTCGAGTTAACAAGCATTCAGCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-882s21c1
Sequence:CCGGGTGTCAAGAGTGTCGACTAAGCTCGAGCTTAGTCGACACTCTTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-992s21c1
Sequence:CCGGATGCAGATCAGACCGTGAATGCTCGAGCATTCACGGTCTGATCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-474s21c1
Sequence:CCGGAGTGGAACCATACTCGCAATACTCGAGTATTGCGAGTATGGTTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005123
NR1H4 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 1, group H, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1581s1c1
Sequence:CCGGCCACTTCTTGATGTGCTACAACTCGAGTTGTAGCACATCAAGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-753s1c1
Sequence:CCGGGCCTCTGGATACCACTATAATCTCGAGATTATAGTGGTATCCAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1660s1c1
Sequence:CCGGGCCTGACTGAATTACGGACATCTCGAGATGTCCGTAATTCAGTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1148s1c1
Sequence:CCGGGCCTCAGGAAATAACAAATAACTCGAGTTATTTGTTATTTCCTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-517s1c1
Sequence:CCGGCCCAAGTTCAACCACAGATTTCTCGAGAAATCTGTGGTTGAACTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-923s21c1
Sequence:CCGGTGTTGGCTGAATGCTTGTTAACTCGAGTTAACAAGCATTCAGCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-882s21c1
Sequence:CCGGGTGTCAAGAGTGTCGACTAAGCTCGAGCTTAGTCGACACTCTTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-992s21c1
Sequence:CCGGATGCAGATCAGACCGTGAATGCTCGAGCATTCACGGTCTGATCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-474s21c1
Sequence:CCGGAGTGGAACCATACTCGCAATACTCGAGTATTGCGAGTATGGTTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005123
NR1H4 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 1, group H, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1581s1c1
Sequence:CCGGCCACTTCTTGATGTGCTACAACTCGAGTTGTAGCACATCAAGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-753s1c1
Sequence:CCGGGCCTCTGGATACCACTATAATCTCGAGATTATAGTGGTATCCAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1660s1c1
Sequence:CCGGGCCTGACTGAATTACGGACATCTCGAGATGTCCGTAATTCAGTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-1148s1c1
Sequence:CCGGGCCTCAGGAAATAACAAATAACTCGAGTTATTTGTTATTTCCTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005123.1-517s1c1
Sequence:CCGGCCCAAGTTCAACCACAGATTTCTCGAGAAATCTGTGGTTGAACTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-923s21c1
Sequence:CCGGTGTTGGCTGAATGCTTGTTAACTCGAGTTAACAAGCATTCAGCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-882s21c1
Sequence:CCGGGTGTCAAGAGTGTCGACTAAGCTCGAGCTTAGTCGACACTCTTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-992s21c1
Sequence:CCGGATGCAGATCAGACCGTGAATGCTCGAGCATTCACGGTCTGATCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005123.2-474s21c1
Sequence:CCGGAGTGGAACCATACTCGCAATACTCGAGTATTGCGAGTATGGTTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)