EMAIL THIS PAGE TO A FRIEND

NR2C2

nuclear receptor subfamily 2, group C, member 2

153 Gene Product Result for
Synonyms: TAK1 TR2R1 TR4 hTAK1
UniProtKB ID: P49116, A8K3H5, B6ZGT8, P55092
Gene ID:
Human(7182) Summary: Members of the nuclear hormone receptor family, such as NR2C2, act as ligand-activated transcription factors. The proteins have an N-terminal transactivation domain, a central DNA-binding domain with 2 zinc fingers, and a ligand-binding domain at the C terminus. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes (Yoshikawa et al., 1996 [PubMed 8661150]
Mouse(22026) nuclear receptor subfamily 2, group C, member 2
Rat(50659) nuclear receptor subfamily 2, group C, member 2
sheep(101104533) nuclear receptor subfamily 2, group C, member 2
naked mole-rat(101700057) nuclear receptor subfamily 2, group C, member 2
domestic guinea pig(100722223) nuclear receptor subfamily 2, group C, member 2
Zebrafish(569321) nuclear receptor subfamily 2, group C, member 2
chicken(395253) nuclear receptor subfamily 2, group C, member 2
cow(505531) nuclear receptor subfamily 2, group C, member 2
Horse(100050658) nuclear receptor subfamily 2, group C, member 2
domestic cat(101100195) nuclear receptor subfamily 2, group C, member 2
dog(484641) nuclear receptor subfamily 2, group C, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_132700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003298 siRNAs that have been validated in the lab human pricing
NM_017323 Rosetta Predictions rat pricing
XM_579411 Rosetta Predictions rat pricing
NM_011630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003298 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148350 validated 1201
2 SASI_Hs01_00148351 predicted 1379
3 SASI_Hs01_00148352 predicted 1400
4 SASI_Hs01_00148353 predicted 942
5 SASI_Hs01_00148354 predicted 928
6 SASI_Hs01_00148356 predicted 1352
7 SASI_Hs02_00335389 predicted 734
8 SASI_Hs01_00148357 predicted 1420
9 SASI_Hs02_00335390 predicted 1648
10 SASI_Hs01_00148358 predicted 818
11 SASI_Hs01_00148349 predicted 803
12 SASI_Hs01_00148355 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078505 predicted 1272
2 SASI_Rn01_00078506 predicted 1024
3 SASI_Rn01_00078507 predicted 1097
4 SASI_Rn01_00078508 predicted 1258
5 SASI_Rn01_00078509 predicted 1249
6 SASI_Rn01_00078510 predicted 230
7 SASI_Rn01_00078511 predicted 768
8 SASI_Rn01_00078513 predicted 1296
9 SASI_Rn01_00078514 predicted 1620
10 SASI_Rn02_00261773 predicted 1042
11 SASI_Rn01_00078512 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184877 predicted 1264
2 SASI_Rn01_00184878 predicted 1019
3 SASI_Rn01_00184879 predicted 833
4 SASI_Rn01_00184880 predicted 1088
5 SASI_Rn01_00184881 predicted 1254
6 SASI_Rn01_00184882 predicted 1236
7 SASI_Rn01_00184883 predicted 768
8 SASI_Rn01_00184884 predicted 1295
9 SASI_Rn01_00184885 predicted 717
10 SASI_Rn01_00184886 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321076 predicted 1442
2 SASI_Mm01_00176650 predicted 736
3 SASI_Mm01_00176651 predicted 994
4 SASI_Mm01_00176652 predicted 1147
5 SASI_Mm01_00176654 predicted 1330
6 SASI_Mm01_00176655 predicted 1169
7 SASI_Mm01_00176656 predicted 1108
8 SASI_Mm01_00176657 predicted 1174
9 SASI_Mm01_00176658 predicted 1120
10 SASI_Mm02_00321077 predicted 1441
11 SASI_Mm01_00176653 predicted 1016
12 SASI_Mm01_00176659 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132700
VALIDATED
NR2C2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group C, member 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-678s1c1
Sequence:CCGGCCTGAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-1286s1c1
Sequence:CCGGGCTATGAGTACGCATACCTTACTCGAGTAAGGTATGCGTACTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-58s1c1
Sequence:CCGGCCTCAGCGCATTCAGATTGTACTCGAGTACAATCTGAATGCGCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132700.4-1484s1c1
Sequence:CCGGCCAACATAACAGAAGAACTTTCTCGAGAAAGTTCTTCTGTTATGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132700
VALIDATED
NR2C2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group C, member 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-678s1c1
Sequence:CCGGCCTGAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-1286s1c1
Sequence:CCGGGCTATGAGTACGCATACCTTACTCGAGTAAGGTATGCGTACTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-58s1c1
Sequence:CCGGCCTCAGCGCATTCAGATTGTACTCGAGTACAATCTGAATGCGCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132700.4-1484s1c1
Sequence:CCGGCCAACATAACAGAAGAACTTTCTCGAGAAAGTTCTTCTGTTATGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132700
VALIDATED
NR2C2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group C, member 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-678s1c1
Sequence:CCGGCCTGAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-1286s1c1
Sequence:CCGGGCTATGAGTACGCATACCTTACTCGAGTAAGGTATGCGTACTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132700.4-58s1c1
Sequence:CCGGCCTCAGCGCATTCAGATTGTACTCGAGTACAATCTGAATGCGCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132700.4-1484s1c1
Sequence:CCGGCCAACATAACAGAAGAACTTTCTCGAGAAAGTTCTTCTGTTATGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003298
VALIDATED
NR2C2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group C, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1798s1c1
Sequence:CCGGCCAGCACAAGCCAGATTGAAACTCGAGTTTCAATCTGGCTTGTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1130s1c1
Sequence:CCGGCCTAAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003298.2-1057s1c1
Sequence:CCGGCCACGGATTCTAAGGCTGAAACTCGAGTTTCAGCCTTAGAATCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1370s1c1
Sequence:CCGGCGTCACATTTAAGCTAACAATCTCGAGATTGTTAGCTTAAATGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-6401s21c1
Sequence:CCGGAGGGTGACATTTCCGTATATTCTCGAGAATATACGGAAATGTCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1742s21c1
Sequence:CCGGTATGAGTATGCATACCTTAAACTCGAGTTTAAGGTATGCATACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1738s1c1
Sequence:CCGGGCTATGAGTATGCATACCTTACTCGAGTAAGGTATGCATACTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1926s21c1
Sequence:CCGGGGCTGATGAGCTCCAACATAACTCGAGTTATGTTGGAGCTCATCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1716s21c1
Sequence:CCGGGCATGGCGAAGCTGGATATAGCTCGAGCTATATCCAGCTTCGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003298.3-489s21c1
Sequence:CCGGCCAGCGCCAAGCAACTCATATCTCGAGATATGAGTTGCTTGGCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003298
VALIDATED
NR2C2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group C, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1798s1c1
Sequence:CCGGCCAGCACAAGCCAGATTGAAACTCGAGTTTCAATCTGGCTTGTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1130s1c1
Sequence:CCGGCCTAAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003298.2-1057s1c1
Sequence:CCGGCCACGGATTCTAAGGCTGAAACTCGAGTTTCAGCCTTAGAATCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1370s1c1
Sequence:CCGGCGTCACATTTAAGCTAACAATCTCGAGATTGTTAGCTTAAATGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-6401s21c1
Sequence:CCGGAGGGTGACATTTCCGTATATTCTCGAGAATATACGGAAATGTCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1742s21c1
Sequence:CCGGTATGAGTATGCATACCTTAAACTCGAGTTTAAGGTATGCATACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1738s1c1
Sequence:CCGGGCTATGAGTATGCATACCTTACTCGAGTAAGGTATGCATACTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1926s21c1
Sequence:CCGGGGCTGATGAGCTCCAACATAACTCGAGTTATGTTGGAGCTCATCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1716s21c1
Sequence:CCGGGCATGGCGAAGCTGGATATAGCTCGAGCTATATCCAGCTTCGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003298.3-489s21c1
Sequence:CCGGCCAGCGCCAAGCAACTCATATCTCGAGATATGAGTTGCTTGGCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003298
VALIDATED
NR2C2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group C, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1798s1c1
Sequence:CCGGCCAGCACAAGCCAGATTGAAACTCGAGTTTCAATCTGGCTTGTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1130s1c1
Sequence:CCGGCCTAAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003298.2-1057s1c1
Sequence:CCGGCCACGGATTCTAAGGCTGAAACTCGAGTTTCAGCCTTAGAATCCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1370s1c1
Sequence:CCGGCGTCACATTTAAGCTAACAATCTCGAGATTGTTAGCTTAAATGTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-6401s21c1
Sequence:CCGGAGGGTGACATTTCCGTATATTCTCGAGAATATACGGAAATGTCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1742s21c1
Sequence:CCGGTATGAGTATGCATACCTTAAACTCGAGTTTAAGGTATGCATACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003298.2-1738s1c1
Sequence:CCGGGCTATGAGTATGCATACCTTACTCGAGTAAGGTATGCATACTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1926s21c1
Sequence:CCGGGGCTGATGAGCTCCAACATAACTCGAGTTATGTTGGAGCTCATCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003298.3-1716s21c1
Sequence:CCGGGCATGGCGAAGCTGGATATAGCTCGAGCTATATCCAGCTTCGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003298.3-489s21c1
Sequence:CCGGCCAGCGCCAAGCAACTCATATCTCGAGATATGAGTTGCTTGGCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011630
NR2C2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group C, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-1508s21c1
Sequence:CCGGGCATGGCGAAACTGGATATAGCTCGAGCTATATCCAGTTTCGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-924s21c1
Sequence:CCGGCCTGAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-1534s21c1
Sequence:CCGGTATGAGTACGCATACCTTAAACTCGAGTTTAAGGTATGCGTACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011630.2-1984s21c1
Sequence:CCGGTCCCAGACAATAGCAACTAAACTCGAGTTTAGTTGCTATTGTCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-283s21c1
Sequence:CCGGAGTGCCAAGCAGCTCATATTCCTCGAGGAATATGAGCTGCTTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011630
NR2C2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group C, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-1508s21c1
Sequence:CCGGGCATGGCGAAACTGGATATAGCTCGAGCTATATCCAGTTTCGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-924s21c1
Sequence:CCGGCCTGAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-1534s21c1
Sequence:CCGGTATGAGTACGCATACCTTAAACTCGAGTTTAAGGTATGCGTACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011630.2-1984s21c1
Sequence:CCGGTCCCAGACAATAGCAACTAAACTCGAGTTTAGTTGCTATTGTCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-283s21c1
Sequence:CCGGAGTGCCAAGCAGCTCATATTCCTCGAGGAATATGAGCTGCTTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011630
NR2C2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group C, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-1508s21c1
Sequence:CCGGGCATGGCGAAACTGGATATAGCTCGAGCTATATCCAGTTTCGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-924s21c1
Sequence:CCGGCCTGAGTGAATCTTTGAACAACTCGAGTTGTTCAAAGATTCACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-1534s21c1
Sequence:CCGGTATGAGTACGCATACCTTAAACTCGAGTTTAAGGTATGCGTACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011630.2-1984s21c1
Sequence:CCGGTCCCAGACAATAGCAACTAAACTCGAGTTTAGTTGCTATTGTCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011630.2-283s21c1
Sequence:CCGGAGTGCCAAGCAGCTCATATTCCTCGAGGAATATGAGCTGCTTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)