EMAIL THIS PAGE TO A FRIEND

NR2C2AP

nuclear receptor 2C2-associated protein

137 Gene Product Result for
Synonyms: TRA16
UniProtKB ID: Q86WQ0, A6NGP7
Gene ID:
Mouse(75692) nuclear receptor 2C2-associated protein
Rat(361128) nuclear receptor 2C2-associated protein
Zebrafish(724051) nuclear receptor 2C2-associated protein
cow(508684) nuclear receptor 2C2-associated protein
domestic cat(101090749) nuclear receptor 2C2-associated protein
dog(609730) nuclear receptor 2C2-associated protein
chicken(100858401) nuclear receptor 2C2-associated protein
domestic guinea pig(100721133) nuclear receptor 2C2-associated protein
naked mole-rat(101712280) nuclear receptor 2C2-associated protein
sheep(101106004) nuclear receptor 2C2-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176880 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176880 Rosetta Predictions human pricing
NM_001047104 Rosetta Predictions rat pricing
XM_341415 Rosetta Predictions rat pricing
NM_001025586 Rosetta Predictions mouse pricing
NM_001025587 Rosetta Predictions mouse pricing
NM_001025588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369264 predicted 608
2 SASI_Hs01_00103367 predicted 829
3 SASI_Hs01_00103368 predicted 609
4 SASI_Hs01_00103370 predicted 682
5 SASI_Hs01_00103371 predicted 649
6 SASI_Hs01_00103372 predicted 707
7 SASI_Hs02_00369265 predicted 671
8 SASI_Hs01_00103373 predicted 823
9 SASI_Hs01_00103375 predicted 775
10 SASI_Hs01_00103376 predicted 595
11 SASI_Hs01_00103369 predicted 391
12 SASI_Hs01_00103374 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205974 predicted 224
2 SASI_Rn02_00205975 predicted 418
3 SASI_Rn02_00205976 predicted 1041
4 SASI_Rn02_00205977 predicted 1036
5 SASI_Rn02_00205978 predicted 250
6 SASI_Rn02_00205979 predicted 383
7 SASI_Rn02_00205980 predicted 446
8 SASI_Rn02_00205981 predicted 447
9 SASI_Rn02_00205982 predicted 449
10 SASI_Rn02_00205983 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143846 predicted 228
2 SASI_Rn01_00143847 predicted 327
3 SASI_Rn01_00143848 predicted 417
4 SASI_Rn01_00143849 predicted 209
5 SASI_Rn01_00143850 predicted 419
6 SASI_Rn01_00143851 predicted 414
7 SASI_Rn01_00143852 predicted 216
8 SASI_Rn01_00143853 predicted 387
9 SASI_Rn01_00143854 predicted 215
10 SASI_Rn01_00143855 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287932 predicted 247
2 SASI_Mm01_00029480 predicted 880
3 SASI_Mm02_00287933 predicted 290
4 SASI_Mm02_00287934 predicted 293
5 SASI_Mm02_00287935 predicted 252
6 SASI_Mm02_00287936 predicted 269
7 SASI_Mm01_00029484 predicted 798
8 SASI_Mm01_00029485 predicted 884
9 SASI_Mm01_00029486 predicted 776
10 SASI_Mm02_00287937 predicted 284
11 SASI_Mm01_00029481 predicted 766
12 SASI_Mm01_00029482 predicted 933
13 SASI_Mm01_00029483 predicted 856
14 SASI_Mm01_00029487 predicted 782
15 SASI_Mm01_00029488 predicted 933
16 SASI_Mm01_00029489 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287938 predicted 245
2 SASI_Mm01_00108210 predicted 872
3 SASI_Mm02_00287939 predicted 290
4 SASI_Mm02_00287940 predicted 296
5 SASI_Mm02_00287941 predicted 253
6 SASI_Mm02_00287942 predicted 269
7 SASI_Mm01_00108214 predicted 790
8 SASI_Mm01_00108215 predicted 882
9 SASI_Mm01_00108216 predicted 771
10 SASI_Mm02_00287943 predicted 286
11 SASI_Mm01_00108211 predicted 765
12 SASI_Mm01_00108212 predicted 935
13 SASI_Mm01_00108213 predicted 854
14 SASI_Mm01_00108217 predicted 790
15 SASI_Mm01_00108218 predicted 928
16 SASI_Mm01_00108219 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136016 predicted 770
2 SASI_Mm01_00136017 predicted 655
3 SASI_Mm01_00136018 predicted 835
4 SASI_Mm01_00136019 predicted 743
5 SASI_Mm01_00136020 predicted 689
6 SASI_Mm01_00136021 predicted 789
7 SASI_Mm01_00136022 predicted 667
8 SASI_Mm01_00136023 predicted 676
9 SASI_Mm01_00136024 predicted 827
10 SASI_Mm01_00136025 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176880
VALIDATED
NR2C2AP MISSION shRNA Bacterial Glycerol Stock
nuclear receptor 2C2-associated protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-550s21c1
Sequence:CCGGCAGCTGCAGATCCAGTTTCAGCTCGAGCTGAAACTGGATCTGCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-399s21c1
Sequence:CCGGAGTGAGCAGGGTGAGTTCAGTCTCGAGACTGAACTCACCCTGCTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-464s21c1
Sequence:CCGGACCAGGATGAGGAGACATGTTCTCGAGAACATGTCTCCTCATCCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-681s21c1
Sequence:CCGGCATACCAGCTGCTGAAGTGGACTCGAGTCCACTTCAGCAGCTGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-402s1c1
Sequence:CCGGGAATCGCAACACTCGGCAGTTCTCGAGAACTGCCGAGTGTTGCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-598s1c1
Sequence:CCGGCAGGCTCTCCACAAGATTGTACTCGAGTACAATCTTGTGGAGAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-628s1c1
Sequence:CCGGCCTGAGGACAACAACTCGCTTCTCGAGAAGCGAGTTGTTGTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176880
VALIDATED
NR2C2AP MISSION shRNA shRNA Plasmid DNA
nuclear receptor 2C2-associated protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-550s21c1
Sequence:CCGGCAGCTGCAGATCCAGTTTCAGCTCGAGCTGAAACTGGATCTGCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-399s21c1
Sequence:CCGGAGTGAGCAGGGTGAGTTCAGTCTCGAGACTGAACTCACCCTGCTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-464s21c1
Sequence:CCGGACCAGGATGAGGAGACATGTTCTCGAGAACATGTCTCCTCATCCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-681s21c1
Sequence:CCGGCATACCAGCTGCTGAAGTGGACTCGAGTCCACTTCAGCAGCTGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-402s1c1
Sequence:CCGGGAATCGCAACACTCGGCAGTTCTCGAGAACTGCCGAGTGTTGCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-598s1c1
Sequence:CCGGCAGGCTCTCCACAAGATTGTACTCGAGTACAATCTTGTGGAGAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-628s1c1
Sequence:CCGGCCTGAGGACAACAACTCGCTTCTCGAGAAGCGAGTTGTTGTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176880
VALIDATED
NR2C2AP MISSION shRNA Lentiviral Transduction Particles
nuclear receptor 2C2-associated protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-550s21c1
Sequence:CCGGCAGCTGCAGATCCAGTTTCAGCTCGAGCTGAAACTGGATCTGCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-399s21c1
Sequence:CCGGAGTGAGCAGGGTGAGTTCAGTCTCGAGACTGAACTCACCCTGCTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-464s21c1
Sequence:CCGGACCAGGATGAGGAGACATGTTCTCGAGAACATGTCTCCTCATCCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176880.4-681s21c1
Sequence:CCGGCATACCAGCTGCTGAAGTGGACTCGAGTCCACTTCAGCAGCTGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-402s1c1
Sequence:CCGGGAATCGCAACACTCGGCAGTTCTCGAGAACTGCCGAGTGTTGCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-598s1c1
Sequence:CCGGCAGGCTCTCCACAAGATTGTACTCGAGTACAATCTTGTGGAGAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_176880.3-628s1c1
Sequence:CCGGCCTGAGGACAACAACTCGCTTCTCGAGAAGCGAGTTGTTGTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025588
VALIDATED
NR2C2AP MISSION shRNA Bacterial Glycerol Stock
nuclear receptor 2C2-associated protein
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000184648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-750s1c1
Sequence:CCGGGCTCTGGAACAATCTGAGGATCTCGAGATCCTCAGATTGTTCCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-298s1c1
Sequence:CCGGGCAATTTGGAAAGAAACATCTCTCGAGAGATGTTTCTTTCCAAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-594s1c1
Sequence:CCGGCCTTCAAGTTCTGCACAGATTCTCGAGAATCTGTGCAGAACTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025588
VALIDATED
NR2C2AP MISSION shRNA shRNA Plasmid DNA
nuclear receptor 2C2-associated protein
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000184648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-750s1c1
Sequence:CCGGGCTCTGGAACAATCTGAGGATCTCGAGATCCTCAGATTGTTCCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-298s1c1
Sequence:CCGGGCAATTTGGAAAGAAACATCTCTCGAGAGATGTTTCTTTCCAAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-594s1c1
Sequence:CCGGCCTTCAAGTTCTGCACAGATTCTCGAGAATCTGTGCAGAACTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025588
VALIDATED
NR2C2AP MISSION shRNA Lentiviral Transduction Particles
nuclear receptor 2C2-associated protein
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000184648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-750s1c1
Sequence:CCGGGCTCTGGAACAATCTGAGGATCTCGAGATCCTCAGATTGTTCCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-298s1c1
Sequence:CCGGGCAATTTGGAAAGAAACATCTCTCGAGAGATGTTTCTTTCCAAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025588.1-594s1c1
Sequence:CCGGCCTTCAAGTTCTGCACAGATTCTCGAGAATCTGTGCAGAACTTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025587
NR2C2AP MISSION shRNA Bacterial Glycerol Stock
nuclear receptor 2C2-associated protein
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000180467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025587.1-482s1c1
Sequence:CCGGGCACTCAGCAAGATTGTAGATCTCGAGATCTACAATCTTGCTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025587
NR2C2AP MISSION shRNA shRNA Plasmid DNA
nuclear receptor 2C2-associated protein
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000180467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025587.1-482s1c1
Sequence:CCGGGCACTCAGCAAGATTGTAGATCTCGAGATCTACAATCTTGCTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025587
NR2C2AP MISSION shRNA Lentiviral Transduction Particles
nuclear receptor 2C2-associated protein
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000180467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025587.1-482s1c1
Sequence:CCGGGCACTCAGCAAGATTGTAGATCTCGAGATCTACAATCTTGCTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)