EMAIL THIS PAGE TO A FRIEND

NR2F2

nuclear receptor subfamily 2, group F, member 2

146 Gene Product Result for
Synonyms: ARP1 COUPTFB COUPTFII NF-E3 NR2F1 SVP40 TFCOUP2
UniProtKB ID: P24468, B4DQJ2, B6ZGU1, Q03754, Q3KQR7
Gene ID:
Human(7026) Summary: This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(11819) nuclear receptor subfamily 2, group F, member 2
Rat(113984) nuclear receptor subfamily 2, group F, member 2
Zebrafish(30424) nuclear receptor subfamily 2, group F, member 2
dog(479026) nuclear receptor subfamily 2, group F, member 2
cow(281945) nuclear receptor subfamily 2, group F, member 2
domestic cat(101095018) nuclear receptor subfamily 2, group F, member 2
chicken(386585) nuclear receptor subfamily 2, group F, member 2
domestic guinea pig(100734279) nuclear receptor subfamily 2, group F, member 2
naked mole-rat(101711922) nuclear receptor subfamily 2, group F, member 2
sheep(100286739) nuclear receptor subfamily 2, group F, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021005 siRNAs that have been validated in the lab human pricing
NM_080778 Rosetta Predictions rat pricing
NM_009697 Rosetta Predictions mouse pricing
NM_183261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021005 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116473 validated 1647
1 SASI_Hs01_00116471 validated 1708
1 SASI_Hs01_00116470 validated 1100
2 SASI_Hs01_00116472 predicted 1095
3 SASI_Hs01_00116474 predicted 1529
4 SASI_Hs01_00116475 predicted 1187
5 SASI_Hs01_00116476 predicted 1699
6 SASI_Hs01_00116477 predicted 1429
7 SASI_Hs01_00116478 predicted 1106
8 SASI_Hs02_00354476 predicted 1114
9 SASI_Hs01_00116479 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052818 predicted 703
2 SASI_Rn01_00052819 predicted 1308
3 SASI_Rn01_00052820 predicted 573
4 SASI_Rn01_00052821 predicted 776
5 SASI_Rn01_00052822 predicted 1124
6 SASI_Rn01_00052823 predicted 453
7 SASI_Rn01_00052824 predicted 1161
8 SASI_Rn01_00052825 predicted 1122
9 SASI_Rn01_00052826 predicted 1034
10 SASI_Rn01_00052827 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099283 predicted 1385
2 SASI_Mm01_00099285 predicted 1378
3 SASI_Mm01_00099286 predicted 930
4 SASI_Mm01_00099287 predicted 1239
5 SASI_Mm01_00099289 predicted 1321
6 SASI_Mm01_00099290 predicted 1144
7 SASI_Mm02_00316818 predicted 926
8 SASI_Mm02_00316819 predicted 1241
9 SASI_Mm01_00099291 predicted 1339
10 SASI_Mm01_00099292 predicted 1205
11 SASI_Mm01_00099284 predicted 1284
12 SASI_Mm01_00099288 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180905 predicted 1331
2 SASI_Mm01_00180907 predicted 1329
3 SASI_Mm01_00180908 predicted 879
4 SASI_Mm01_00180909 predicted 1185
5 SASI_Mm01_00180911 predicted 1277
6 SASI_Mm01_00180912 predicted 1090
7 SASI_Mm02_00350343 predicted 873
8 SASI_Mm02_00350344 predicted 1188
9 SASI_Mm01_00180913 predicted 1289
10 SASI_Mm01_00180914 predicted 1156
11 SASI_Mm01_00180906 predicted 1208
12 SASI_Mm01_00180910 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021005
VALIDATED
NR2F2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group F, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-2345s21c1
Sequence:CCGGCCTCCTCAGTCATAGAGCAATCTCGAGATTGCTCTATGACTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021005.3-3473s21c1
Sequence:CCGGCGTGATTGATTCAGTATCTTACTCGAGTAAGATACTGAATCAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-1761s21c1
Sequence:CCGGCGGATATATTTCCCTGCTGTTCTCGAGAACAGCAGGGAAATATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-2448s21c1
Sequence:CCGGGCCGTATATGGCAATTCAATACTCGAGTATTGAATTGCCATATACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021005.2-1702s1c1
Sequence:CCGGCCTCCTCAGTCATAGAGCAATCTCGAGATTGCTCTATGACTGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021005.2-2827s1c1
Sequence:CCGGCGTGATTGATTCAGTATCTTACTCGAGTAAGATACTGAATCAATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021005.2-1437s1c1
Sequence:CCGGGTCGCCTTTATGGACCACATACTCGAGTATGTGGTCCATAAAGGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021005.2-1118s1c1
Sequence:CCGGCGGATATATTTCCCTGCTGTTCTCGAGAACAGCAGGGAAATATATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021005.2-1805s1c1
Sequence:CCGGGCCGTATATGGCAATTCAATACTCGAGTATTGAATTGCCATATACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021005
VALIDATED
NR2F2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group F, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-2345s21c1
Sequence:CCGGCCTCCTCAGTCATAGAGCAATCTCGAGATTGCTCTATGACTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021005.3-3473s21c1
Sequence:CCGGCGTGATTGATTCAGTATCTTACTCGAGTAAGATACTGAATCAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-1761s21c1
Sequence:CCGGCGGATATATTTCCCTGCTGTTCTCGAGAACAGCAGGGAAATATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-2448s21c1
Sequence:CCGGGCCGTATATGGCAATTCAATACTCGAGTATTGAATTGCCATATACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021005.2-1702s1c1
Sequence:CCGGCCTCCTCAGTCATAGAGCAATCTCGAGATTGCTCTATGACTGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021005.2-2827s1c1
Sequence:CCGGCGTGATTGATTCAGTATCTTACTCGAGTAAGATACTGAATCAATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021005.2-1437s1c1
Sequence:CCGGGTCGCCTTTATGGACCACATACTCGAGTATGTGGTCCATAAAGGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021005.2-1118s1c1
Sequence:CCGGCGGATATATTTCCCTGCTGTTCTCGAGAACAGCAGGGAAATATATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021005.2-1805s1c1
Sequence:CCGGGCCGTATATGGCAATTCAATACTCGAGTATTGAATTGCCATATACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021005
VALIDATED
NR2F2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group F, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-2345s21c1
Sequence:CCGGCCTCCTCAGTCATAGAGCAATCTCGAGATTGCTCTATGACTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021005.3-3473s21c1
Sequence:CCGGCGTGATTGATTCAGTATCTTACTCGAGTAAGATACTGAATCAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-1761s21c1
Sequence:CCGGCGGATATATTTCCCTGCTGTTCTCGAGAACAGCAGGGAAATATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021005.3-2448s21c1
Sequence:CCGGGCCGTATATGGCAATTCAATACTCGAGTATTGAATTGCCATATACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021005.2-1702s1c1
Sequence:CCGGCCTCCTCAGTCATAGAGCAATCTCGAGATTGCTCTATGACTGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021005.2-2827s1c1
Sequence:CCGGCGTGATTGATTCAGTATCTTACTCGAGTAAGATACTGAATCAATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021005.2-1437s1c1
Sequence:CCGGGTCGCCTTTATGGACCACATACTCGAGTATGTGGTCCATAAAGGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021005.2-1118s1c1
Sequence:CCGGCGGATATATTTCCCTGCTGTTCTCGAGAACAGCAGGGAAATATATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021005.2-1805s1c1
Sequence:CCGGGCCGTATATGGCAATTCAATACTCGAGTATTGAATTGCCATATACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009697
VALIDATED
NR2F2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group F, member 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-789s21c1
Sequence:CCGGCTCGTACCTGTCCGGATATATCTCGAGATATATCCGGACAGGTACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1386s21c1
Sequence:CCGGCTCCTCAGTCATAGAGCAATTCTCGAGAATTGCTCTATGACTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1750s21c1
Sequence:CCGGACAACCTGCTACTTATCATTTCTCGAGAAATGATAAGTAGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1488s21c1
Sequence:CCGGGCCATATATGGCAATTCAATACTCGAGTATTGAATTGCCATATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1012s21c1
Sequence:CCGGAGCGAGCTGTTCGTGTTGAATCTCGAGATTCAACACGAACAGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1012s1c1
Sequence:CCGGAGCGAGCTGTTCGTGTTGAATCTCGAGATTCAACACGAACAGCTCGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1488s1c1
Sequence:CCGGGCCATATATGGCAATTCAATACTCGAGTATTGAATTGCCATATATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1287s1c1
Sequence:CCGGCCAGTGTGCTTTGGAAGAGTACTCGAGTACTCTTCCAAAGCACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-2656s1c1
Sequence:CCGGCGAGTCTTTGTGTGTTATATTCTCGAGAATATAACACACAAAGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-801s1c1
Sequence:CCGGCGGATATATTTCCCTGCTGCTCTCGAGAGCAGCAGGGAAATATATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009697.2-2395s1c1
Sequence:CCGGCCCTTAGTTCTTGAATTGTTACTCGAGTAACAATTCAAGAACTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-789s1c1
Sequence:CCGGCTCGTACCTGTCCGGATATATCTCGAGATATATCCGGACAGGTACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1339s1c1
Sequence:CCGGCGGTTCGGAAAGCTCTTGCTTCTCGAGAAGCAAGAGCTTTCCGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1132s1c1
Sequence:CCGGGACCACATACGGATCTTCCAACTCGAGTTGGAAGATCCGTATGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1386s1c1
Sequence:CCGGCTCCTCAGTCATAGAGCAATTCTCGAGAATTGCTCTATGACTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009697
VALIDATED
NR2F2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group F, member 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-789s21c1
Sequence:CCGGCTCGTACCTGTCCGGATATATCTCGAGATATATCCGGACAGGTACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1386s21c1
Sequence:CCGGCTCCTCAGTCATAGAGCAATTCTCGAGAATTGCTCTATGACTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1750s21c1
Sequence:CCGGACAACCTGCTACTTATCATTTCTCGAGAAATGATAAGTAGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1488s21c1
Sequence:CCGGGCCATATATGGCAATTCAATACTCGAGTATTGAATTGCCATATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1012s21c1
Sequence:CCGGAGCGAGCTGTTCGTGTTGAATCTCGAGATTCAACACGAACAGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1012s1c1
Sequence:CCGGAGCGAGCTGTTCGTGTTGAATCTCGAGATTCAACACGAACAGCTCGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1488s1c1
Sequence:CCGGGCCATATATGGCAATTCAATACTCGAGTATTGAATTGCCATATATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1287s1c1
Sequence:CCGGCCAGTGTGCTTTGGAAGAGTACTCGAGTACTCTTCCAAAGCACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-2656s1c1
Sequence:CCGGCGAGTCTTTGTGTGTTATATTCTCGAGAATATAACACACAAAGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-801s1c1
Sequence:CCGGCGGATATATTTCCCTGCTGCTCTCGAGAGCAGCAGGGAAATATATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009697.2-2395s1c1
Sequence:CCGGCCCTTAGTTCTTGAATTGTTACTCGAGTAACAATTCAAGAACTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-789s1c1
Sequence:CCGGCTCGTACCTGTCCGGATATATCTCGAGATATATCCGGACAGGTACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1339s1c1
Sequence:CCGGCGGTTCGGAAAGCTCTTGCTTCTCGAGAAGCAAGAGCTTTCCGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1132s1c1
Sequence:CCGGGACCACATACGGATCTTCCAACTCGAGTTGGAAGATCCGTATGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1386s1c1
Sequence:CCGGCTCCTCAGTCATAGAGCAATTCTCGAGAATTGCTCTATGACTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009697
VALIDATED
NR2F2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group F, member 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-789s21c1
Sequence:CCGGCTCGTACCTGTCCGGATATATCTCGAGATATATCCGGACAGGTACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1386s21c1
Sequence:CCGGCTCCTCAGTCATAGAGCAATTCTCGAGAATTGCTCTATGACTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1750s21c1
Sequence:CCGGACAACCTGCTACTTATCATTTCTCGAGAAATGATAAGTAGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1488s21c1
Sequence:CCGGGCCATATATGGCAATTCAATACTCGAGTATTGAATTGCCATATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009697.3-1012s21c1
Sequence:CCGGAGCGAGCTGTTCGTGTTGAATCTCGAGATTCAACACGAACAGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1012s1c1
Sequence:CCGGAGCGAGCTGTTCGTGTTGAATCTCGAGATTCAACACGAACAGCTCGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1488s1c1
Sequence:CCGGGCCATATATGGCAATTCAATACTCGAGTATTGAATTGCCATATATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1287s1c1
Sequence:CCGGCCAGTGTGCTTTGGAAGAGTACTCGAGTACTCTTCCAAAGCACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-2656s1c1
Sequence:CCGGCGAGTCTTTGTGTGTTATATTCTCGAGAATATAACACACAAAGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-801s1c1
Sequence:CCGGCGGATATATTTCCCTGCTGCTCTCGAGAGCAGCAGGGAAATATATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009697.2-2395s1c1
Sequence:CCGGCCCTTAGTTCTTGAATTGTTACTCGAGTAACAATTCAAGAACTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-789s1c1
Sequence:CCGGCTCGTACCTGTCCGGATATATCTCGAGATATATCCGGACAGGTACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1339s1c1
Sequence:CCGGCGGTTCGGAAAGCTCTTGCTTCTCGAGAAGCAAGAGCTTTCCGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009697.2-1132s1c1
Sequence:CCGGGACCACATACGGATCTTCCAACTCGAGTTGGAAGATCCGTATGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009697.2-1386s1c1
Sequence:CCGGCTCCTCAGTCATAGAGCAATTCTCGAGAATTGCTCTATGACTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)