EMAIL THIS PAGE TO A FRIEND

NR3C1

nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)

504 Gene Product Result for
Synonyms: GCCR GCR GR GRL
Gene ID:
Human(2908) Summary: This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]
Mouse(14815) nuclear receptor subfamily 3, group C, member 1
Rat(24413) nuclear receptor subfamily 3, group C, member 1
Zebrafish(553740) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
chicken(416343) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
dog(478047) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
domestic cat(692348) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
cow(281946) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Horse(100061217) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
domestic cat(101080939) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
domestic guinea pig(100135583) nuclear receptor subfamily 3, group C, member 1
naked mole-rat(101722101) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Domestic Rabbit(100008890) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
sheep(443412) nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
ABE1424 Anti-Glucocorticoid Receptor Antibody serum, clone, from rabbit mouse, mouse, human, human
affinity binding assay, western blot pricing
05-827 Anti-Glucocorticoid Receptor Antibody, clone FIGR clone FIGR, Upstate®, from mouse hamster, rat, mouse
immunoprecipitation (IP), western blot pricing
SAB4501309 Anti-GR antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501310 Anti-GR antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501311 Anti-GR antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
HPA004248 Anti-NR3C1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, western blot pricing
SAB1408583 Anti-NR3C1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101649 Anti-NR3C1 antibody produced in rabbit affinity isolated antibody pig, human, bovine
immunohistochemistry, western blot pricing
AV100765 Anti-NR3C1 antibody produced in rabbit IgG fraction of antiserum western blot pricing
ABS1008 Anti-phospho Glucocorticoid Receptor (Ser134) Antibody clone, from rabbit, purified by affinity chromatography human, rat, human, rat
western blot pricing
ABS994 Anti-phospho-Glucocorticoid receptor Antibody, Ser226 clone, from rabbit, purified by affinity chromatography human, human
western blot pricing
SAB4504585 Anti-phospho-GR (pSer203) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301558 Anti-phospho-GR (pSer203) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503820 Anti-phospho-GR (pSer211) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503874 Anti-phospho-GR (pSer226) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301435 Anti-phospho-GR (pSer226) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4800041 Imprint® Monoclonal Anti-GR antibody produced in mouse purified antibody, buffered aqueous solution human
ChIP, ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
34206 6-α-Fluoroprednisolone VETRANAL®, analytical standard human pricing
D6288 6α,9α-Difluoroprednisolone 21-acetate 17-butyrate ≥98% human pricing
M0388 6α-Methyl-11β-hydroxyprogesterone human pricing
46436 6α-Methylprednisolone VETRANAL®, analytical standard human pricing
M3781 6α-Methylprednisolone 21-hemisuccinate sodium salt lyophilized powder human pricing
A2428 Amcinonide analytical standard human pricing
1019202 Amcinonide United States Pharmacopeia (USP) Reference Standard human pricing
BP030 Beclometasone (beclomethasone) dipropionate British Pharmacopoeia (BP) Assay Standard human pricing
Y0000469 Beclometasone dipropionate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000352 Beclometasone dipropionate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
B3022 Beclomethasone dipropionate analytical standard, for drug analysis human pricing
1048506 Beclomethasone dipropionate United States Pharmacopeia (USP) Reference Standard human pricing
B0305000 Beclomethasone dipropionate anhydrous, European Pharmacopoeia (EP) Reference Standard human pricing
PHR1619 Beclomethasone Dipropionate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
PHR1398 Betamethasone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
34166 Betamethasone VETRANAL®, analytical standard human pricing
1066009 Betamethasone United States Pharmacopeia (USP) Reference Standard human pricing
B1000000 Betamethasone European Pharmacopoeia (EP) Reference Standard human pricing
18081 Betamethasone pharmaceutical impurity standard, ≥95.0% (HPLC) human pricing
BP575 Betamethasone British Pharmacopoeia (BP) Reference Standard human pricing
B7652 Betamethasone 21-phosphate disodium ≥97% human pricing
1067001 Betamethasone acetate United States Pharmacopeia (USP) Reference Standard human pricing
B1030000 Betamethasone acetate European Pharmacopoeia (EP) Reference Standard human pricing
PHR1779 Betamethasone Acetate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1068004 Betamethasone sodium phosphate United States Pharmacopeia (USP) Reference Standard human pricing
B1045000 Betamethasone sodium phosphate European Pharmacopoeia (EP) Reference Standard human pricing
BP041 Betamethasone sodium phosphate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1178 Budesonide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1078201 Budesonide United States Pharmacopeia (USP) Reference Standard human pricing
B1157300 Budesonide European Pharmacopoeia (EP) Reference Standard human pricing
BP793 Budesonide British Pharmacopoeia (BP) Reference Standard human pricing
BP894 Budesonide impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
Y0000570 Clobetasol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
1138405 Clobetasol propionate United States Pharmacopeia (USP) Reference Standard human pricing
Y0000559 Clobetasol propionate European Pharmacopoeia (EP) Reference Standard human pricing
BP521 Clobetasol propionate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1921 Clobetasol Propionate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0002164 Clobetasol propionate for peak identification CRS, European Pharmacopoeia (EP) Reference Standard human pricing
NIST921 Cortisol (Hydrocortisone) NIST® SRM® 921 human pricing
C-106 Cortisol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C3130 Cortisone 21-acetate ≥99% human pricing
1150003 Cortisone acetate United States Pharmacopeia (USP) Reference Standard human pricing
C2800000 Cortisone acetate European Pharmacopoeia (EP) Reference Standard human pricing
BP585 Cortisone acetate British Pharmacopoeia (BP) Reference Standard human pricing
SML0123 Deflazacort ≥98% (HPLC) human pricing
1166116 Deflazacort United States Pharmacopeia (USP) Reference Standard human pricing
CDS021596 Desonide human pricing
1173508 Desoximetasone United States Pharmacopeia (USP) Reference Standard human pricing
D6038 Desoximetasone human pricing
PHR1526 Dexamethasone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1176007 Dexamethasone United States Pharmacopeia (USP) Reference Standard human pricing
D0700000 Dexamethasone European Pharmacopoeia (EP) Reference Standard human pricing
BP578 Dexamethasone British Pharmacopoeia (BP) Assay Standard human pricing
31381 Dexamethasone ≥97.0% (HPLC) human pricing
D1881 Dexamethasone 21-acetate ≥99% human pricing
46166 Dexamethasone 21-acetate VETRANAL®, analytical standard human pricing
D1159 Dexamethasone 21-phosphate disodium salt ≥98% human pricing
1176506 Dexamethasone acetate United States Pharmacopeia (USP) Reference Standard human pricing
D0710000 Dexamethasone acetate European Pharmacopoeia (EP) Reference Standard human pricing
PHR1527 Dexamethasone Acetate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001593 Dexamethasone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001177 Dexamethasone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP811 Dexamethasone impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
D0720000 Dexamethasone sodium phosphate European Pharmacopoeia (EP) Reference Standard human pricing
1177032 Dexamethasone sodium phosphate United States Pharmacopeia (USP) Reference Standard human pricing
BP108 Dexamethasone sodium phosphate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1768 Dexamethasone Sodium Phosphate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001477 Dexamethasone sodium phosphate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
D-085 Dexamethasone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1197302 Diflorasone diacetate United States Pharmacopeia (USP) Reference Standard human pricing
1274006 Flumethasone pivalate United States Pharmacopeia (USP) Reference Standard human pricing
F0891 Flumethasone pivalate human pricing
F0188500 Flumethasone pivalate European Pharmacopoeia (EP) Reference Standard human pricing
BP1156 Flumethasone pivalate British Pharmacopoeia (BP) Reference Standard human pricing
F8880 Fluocinolone acetonide analytical standard human pricing
F0200000 Fluocinolone acetonide European Pharmacopoeia (EP) Reference Standard human pricing
1275009 Fluocinolone acetonide United States Pharmacopeia (USP) Reference Standard human pricing
PHR1397 Fluocinolone Acetonide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001711 Fluocinolone acetonide for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001710 Fluocinolone acetonide for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1276001 Fluocinonide United States Pharmacopeia (USP) Reference Standard human pricing
SML0099 Fluocinonide ≥98% (HPLC) human pricing
BP489 Fluocinonide British Pharmacopoeia (BP) Reference Standard human pricing
F9381 Fluorometholone ≥98% human pricing
1278007 Fluorometholone United States Pharmacopeia (USP) Reference Standard human pricing
BP573 Fluorometholone British Pharmacopoeia (BP) Reference Standard human pricing
F9428 Fluticasone propionate ≥98% (HPLC), powder human pricing
1285873 Fluticasone propionate United States Pharmacopeia (USP) Reference Standard human pricing
Y0000284 Fluticasone propionate European Pharmacopoeia (EP) Reference Standard human pricing
BP587 Fluticasone propionate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1702 Fluticasone Propionate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001754 Fluticasone propionate for impurity C identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001755 Fluticasone propionate for impurity G identification European Pharmacopoeia (EP) Reference Standard human pricing
1302509 Halcinonide United States Pharmacopeia (USP) Reference Standard human pricing
PHR1014 Hydrocortisone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1316004 Hydrocortisone United States Pharmacopeia (USP) Reference Standard human pricing
H1300000 Hydrocortisone European Pharmacopoeia (EP) Reference Standard human pricing
31719 Hydrocortisone VETRANAL®, analytical standard human pricing
286095 Hydrocortisone 98% human pricing
BP576 Hydrocortisone British Pharmacopoeia (BP) Assay Standard human pricing
H5270 Hydrocortisone 17-butyrate human pricing
H5395 Hydrocortisone 17-valerate analytical standard human pricing
H4126 Hydrocortisone 21-acetate ≥98% (HPLC) human pricing
H3035 Hydrocortisone 21-acetate meets USP testing specifications human pricing
H5760 Hydrocortisone 21-acetate Sigma Reference Standard human pricing
46329 Hydrocortisone 21-acetate VETRANAL®, analytical standard human pricing
54102 Hydrocortisone 21-acetate tested according to Ph Eur human pricing
H2882 Hydrocortisone 21-hemisuccinate analytical standard human pricing
H4881 Hydrocortisone 21-hemisuccinate sodium salt ≥90% (HPLC) human pricing
H2270 Hydrocortisone 21-hemisuccinate sodium salt powder, BioReagent, suitable for cell culture human pricing
H1400000 Hydrocortisone acetate European Pharmacopoeia (EP) Reference Standard human pricing
1317007 Hydrocortisone acetate United States Pharmacopeia (USP) Reference Standard human pricing
BP584 Hydrocortisone acetate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1606 Hydrocortisone Acetate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001482 Hydrocortisone acetate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
1317302 Hydrocortisone butyrate United States Pharmacopeia (USP) Reference Standard human pricing
Y0001092 Hydrocortisone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
H1425000 Hydrocortisone hydrogen succinate European Pharmacopoeia (EP) Reference Standard human pricing
BP187 Hydrocortisone hydrogen succinate British Pharmacopoeia (BP) Reference Standard human pricing
1321004 Hydrocortisone valerate United States Pharmacopeia (USP) Reference Standard human pricing
SML0547 Loteprednol Etabonate ≥98% (HPLC) human pricing
1435003 Methylprednisolone United States Pharmacopeia (USP) Reference Standard human pricing
PHR1717 Methylprednisolone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M1750000 Methylprednisolone European Pharmacopoeia (EP) Reference Standard human pricing
BP248 Methylprednisolone British Pharmacopoeia (BP) Reference Standard human pricing
Y0001602 Methylprednisolone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0001799 Methylprednisolone for system suitability A European Pharmacopoeia (EP) Reference Standard human pricing
1445470 Mometasone furoate United States Pharmacopeia (USP) Reference Standard human pricing
M4074 Mometasone furoate ≥98% (HPLC) human pricing
M2900000 Mometasone furoate European Pharmacopoeia (EP) Reference Standard human pricing
BP768 Mometasone furoate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1400 Mometasone Furoate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001977 Mometasone furoate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1043 Prednisolone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1555005 Prednisolone United States Pharmacopeia (USP) Reference Standard human pricing
P2700000 Prednisolone European Pharmacopoeia (EP) Reference Standard human pricing
46656 Prednisolone VETRANAL®, analytical standard human pricing
BP464 Prednisolone British Pharmacopoeia (BP) Assay Standard human pricing
P8650 Prednisolone 21-acetate ≥97% human pricing
46657 Prednisolone 21-acetate VETRANAL®, analytical standard human pricing
1556008 Prednisolone acetate United States Pharmacopeia (USP) Reference Standard human pricing
P2800000 Prednisolone acetate European Pharmacopoeia (EP) Reference Standard human pricing
BP1140 Prednisolone acetate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1630 Prednisolone Acetate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000582 Prednisolone acetate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001359 Prednisolone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001355 Prednisolone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
P-121 Prednisolone solution 100 μg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1559006 Prednisone United States Pharmacopeia (USP) Reference Standard human pricing
P6254 Prednisone ≥98% human pricing
PHR1042 Prednisone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
P2900000 Prednisone European Pharmacopoeia (EP) Reference Standard human pricing
81552 Prednisone tested according to Ph Eur human pricing
67298 Prednisone pharmaceutical secondary standard; traceable to USP, PhEur and BP human pricing
BP553 Prednisone British Pharmacopoeia (BP) Reference Standard human pricing
Y0001921 Prednisone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001920 Prednisone impurity B European Pharmacopoeia (EP) Reference Standard human pricing
P-122 Prednisone solution 100 μg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T6376 Triamcinolone human pricing
1676000 Triamcinolone United States Pharmacopeia (USP) Reference Standard human pricing
T1899990 Triamcinolone European Pharmacopoeia (EP) Reference Standard human pricing
287334 Triamcinolone human pricing
BP338 Triamcinolone British Pharmacopoeia (BP) Reference Standard human pricing
T6501 Triamcinolone acetonide analytical standard human pricing
1677002 Triamcinolone acetonide United States Pharmacopeia (USP) Reference Standard human pricing
T1900000 Triamcinolone acetonide European Pharmacopoeia (EP) Reference Standard human pricing
BP339 Triamcinolone acetonide British Pharmacopoeia (BP) Reference Standard human pricing
PHR1701 Triamcinolone Acetonide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001459 Triamcinolone acetonide for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1678005 Triamcinolone diacetate United States Pharmacopeia (USP) Reference Standard human pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
M0639 6α-Methylprednisolone ≥98% human, rat pricing
B7777 Budesonide ≥99% human, rat pricing
C8037 Clobetasol propionate analytical standard human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C3283000 Cyproterone acetate European Pharmacopoeia (EP) Reference Standard human pricing
BP688 Cyproterone acetate British Pharmacopoeia (BP) Reference Standard human pricing
Y0001390 Cyproterone acetate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
1443759 Mifepristone United States Pharmacopeia (USP) Reference Standard human pricing
A8380 5α-Androstan-17β-ol-3-one ≥97.5% human, mouse, rat pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
C3412 Cyproterone acetate ≥98% human, mouse, rat pricing
P6004 Prednisolone ≥99% human, mouse, rat pricing
P0130 Progesterone ≥99% human, mouse, rat pricing
P8783 Progesterone powder, BioReagent, suitable for cell culture human, mouse, rat pricing
P6149 Progesterone γ-irradiated, BioXtra, suitable for cell culture human, mouse, rat pricing
P3972 Progesterone meets USP testing specifications human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
T1500 Testosterone ≥98% human, mouse, rat pricing
T5411 Testosterone solution 1.0 mg/mL in 1,2-dimethoxyethane, drug standard human, mouse, rat pricing
C2505 Corticosterone ≥92% human, rat pricing
27840 Corticosterone ≥98.5% (HPLC) human, rat pricing
M1629 Medroxyprogesterone 17-acetate ≥97% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000176 Rosetta Predictions human pricing
NM_001018074 Rosetta Predictions human pricing
NM_001018075 Rosetta Predictions human pricing
NM_001018076 Rosetta Predictions human pricing
NM_001018077 Rosetta Predictions human pricing
NM_001020825 Rosetta Predictions human pricing
NM_001024094 Rosetta Predictions human pricing
NM_012576 Rosetta Predictions rat pricing
NM_008173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036406 predicted 1379
2 SASI_Hs01_00036408 predicted 2404
3 SASI_Hs01_00036409 predicted 2396
4 SASI_Hs01_00036410 predicted 1552
5 SASI_Hs01_00036411 predicted 2244
6 SASI_Hs01_00036412 predicted 2241
7 SASI_Hs01_00036413 predicted 2442
8 SASI_Hs01_00036414 predicted 1098
9 SASI_Hs02_00302014 predicted 724
10 SASI_Hs02_00302015 predicted 2357
11 SASI_Hs01_00036407 predicted 858
12 SASI_Hs01_00036415 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188611 predicted 1212
2 SASI_Hs01_00188613 predicted 2226
3 SASI_Hs01_00188614 predicted 2235
4 SASI_Hs01_00188615 predicted 1383
5 SASI_Hs01_00188616 predicted 2073
6 SASI_Hs01_00188617 predicted 2067
7 SASI_Hs01_00188618 predicted 2272
8 SASI_Hs01_00188619 predicted 925
9 SASI_Hs02_00306973 predicted 549
10 SASI_Hs02_00306974 predicted 2190
11 SASI_Hs01_00188612 predicted 696
12 SASI_Hs01_00188620 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137914 predicted 1115
2 SASI_Hs01_00137916 predicted 2135
3 SASI_Hs01_00137917 predicted 2135
4 SASI_Hs01_00137918 predicted 1289
5 SASI_Hs01_00137919 predicted 1981
6 SASI_Hs01_00137920 predicted 1978
7 SASI_Hs01_00137921 predicted 2180
8 SASI_Hs01_00137922 predicted 831
9 SASI_Hs02_00306975 predicted 459
10 SASI_Hs02_00306976 predicted 2098
11 SASI_Hs01_00137915 predicted 592
12 SASI_Hs01_00137923 predicted 1934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210229 predicted 1005
2 SASI_Hs01_00210231 predicted 2024
3 SASI_Hs01_00210232 predicted 2028
4 SASI_Hs01_00210233 predicted 1176
5 SASI_Hs01_00210234 predicted 1874
6 SASI_Hs01_00210235 predicted 1870
7 SASI_Hs01_00210236 predicted 2070
8 SASI_Hs01_00210237 predicted 728
9 SASI_Hs02_00306977 predicted 345
10 SASI_Hs02_00306978 predicted 1982
11 SASI_Hs01_00210230 predicted 483
12 SASI_Hs01_00210238 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104021 predicted 1887
2 SASI_Hs01_00104023 predicted 2905
3 SASI_Hs01_00104024 predicted 2903
4 SASI_Hs01_00104025 predicted 2051
5 SASI_Hs01_00104026 predicted 2750
6 SASI_Hs01_00104027 predicted 2746
7 SASI_Hs01_00104028 predicted 2947
8 SASI_Hs01_00104029 predicted 1600
9 SASI_Hs02_00306979 predicted 1221
10 SASI_Hs02_00306980 predicted 2864
11 SASI_Hs01_00104022 predicted 1367
12 SASI_Hs01_00104030 predicted 2706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001020825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048410 predicted 1379
2 SASI_Hs01_00048412 predicted 2396
3 SASI_Hs01_00048413 predicted 2397
4 SASI_Hs01_00048414 predicted 1553
5 SASI_Hs01_00048415 predicted 2242
6 SASI_Hs01_00048416 predicted 2241
7 SASI_Hs01_00048417 predicted 2438
8 SASI_Hs01_00048418 predicted 1093
9 SASI_Hs02_00307067 predicted 722
10 SASI_Hs02_00307068 predicted 2361
11 SASI_Hs01_00048411 predicted 866
12 SASI_Hs01_00048419 predicted 2206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050274 predicted 1382
2 SASI_Hs01_00050276 predicted 2407
3 SASI_Hs01_00050277 predicted 2408
4 SASI_Hs01_00050278 predicted 1556
5 SASI_Hs01_00050279 predicted 2245
6 SASI_Hs01_00050280 predicted 2239
7 SASI_Hs01_00050281 predicted 2441
8 SASI_Hs01_00050282 predicted 1094
9 SASI_Hs02_00307113 predicted 720
10 SASI_Hs02_00307114 predicted 2367
11 SASI_Hs01_00050275 predicted 867
12 SASI_Hs01_00050283 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259702 predicted 1821
2 SASI_Rn01_00092098 predicted 2031
3 SASI_Rn01_00092099 predicted 2109
4 SASI_Rn01_00092100 predicted 2119
5 SASI_Rn01_00092101 predicted 1774
6 SASI_Rn01_00092102 predicted 843
7 SASI_Rn01_00092103 predicted 1972
8 SASI_Rn02_00259703 predicted 1950
9 SASI_Rn01_00092104 predicted 1250
10 SASI_Rn02_00259704 predicted 1813
11 SASI_Rn01_00092097 predicted 1881
12 SASI_Rn01_00092105 predicted 1880
13 SASI_Rn01_00092106 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037534 predicted 784
2 SASI_Mm01_00037535 predicted 2028
3 SASI_Mm01_00037536 predicted 1012
4 SASI_Mm01_00037537 predicted 2102
5 SASI_Mm01_00037538 predicted 978
6 SASI_Mm01_00037539 predicted 2114
7 SASI_Mm01_00037540 predicted 1808
8 SASI_Mm01_00037541 predicted 1493
9 SASI_Mm02_00313296 predicted 671
10 SASI_Mm01_00037543 predicted 1245
11 SASI_Mm01_00037542 predicted 2176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000176
VALIDATED
NR3C1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-6190s21c1
Sequence:CCGGTTGGGTGGAGTTTCGTAATTTCTCGAGAAATTACGAAACTCCACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2452s21c1
Sequence:CCGGCACAGGCTTCAGGTATCTTATCTCGAGATAAGATACCTGAAGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2089s21c1
Sequence:CCGGGTGTCACTGTTGGAGGTTATTCTCGAGAATAACCTCCAACAGTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-1177s21c1
Sequence:CCGGGCGGGAGAAGACGATTCATTCCTCGAGGAATGAATCGTCTTCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-1928s1c1
Sequence:CCGGCCTGGATGTTTCTTATGGCATCTCGAGATGCCATAAGAAACATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-1319s1c1
Sequence:CCGGCCAGCATGAGACCAGATGTAACTCGAGTTACATCTGGTCTCATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2714s21c1
Sequence:CCGGTGGATAAGACCATGAGTATTGCTCGAGCAATACTCATGGTCTTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-663s1c1
Sequence:CCGGCGGTGGCAATGTGAAATTGTACTCGAGTACAATTTCACATTGCCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000176
VALIDATED
NR3C1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-6190s21c1
Sequence:CCGGTTGGGTGGAGTTTCGTAATTTCTCGAGAAATTACGAAACTCCACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2452s21c1
Sequence:CCGGCACAGGCTTCAGGTATCTTATCTCGAGATAAGATACCTGAAGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2089s21c1
Sequence:CCGGGTGTCACTGTTGGAGGTTATTCTCGAGAATAACCTCCAACAGTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-1177s21c1
Sequence:CCGGGCGGGAGAAGACGATTCATTCCTCGAGGAATGAATCGTCTTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-1928s1c1
Sequence:CCGGCCTGGATGTTTCTTATGGCATCTCGAGATGCCATAAGAAACATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-1319s1c1
Sequence:CCGGCCAGCATGAGACCAGATGTAACTCGAGTTACATCTGGTCTCATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2714s21c1
Sequence:CCGGTGGATAAGACCATGAGTATTGCTCGAGCAATACTCATGGTCTTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-663s1c1
Sequence:CCGGCGGTGGCAATGTGAAATTGTACTCGAGTACAATTTCACATTGCCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000176
VALIDATED
NR3C1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-6190s21c1
Sequence:CCGGTTGGGTGGAGTTTCGTAATTTCTCGAGAAATTACGAAACTCCACCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2452s21c1
Sequence:CCGGCACAGGCTTCAGGTATCTTATCTCGAGATAAGATACCTGAAGCCTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2089s21c1
Sequence:CCGGGTGTCACTGTTGGAGGTTATTCTCGAGAATAACCTCCAACAGTGACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-1177s21c1
Sequence:CCGGGCGGGAGAAGACGATTCATTCCTCGAGGAATGAATCGTCTTCTCCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-1928s1c1
Sequence:CCGGCCTGGATGTTTCTTATGGCATCTCGAGATGCCATAAGAAACATCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-1319s1c1
Sequence:CCGGCCAGCATGAGACCAGATGTAACTCGAGTTACATCTGGTCTCATGCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000176.2-2714s21c1
Sequence:CCGGTGGATAAGACCATGAGTATTGCTCGAGCAATACTCATGGTCTTATCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000176.1-663s1c1
Sequence:CCGGCGGTGGCAATGTGAAATTGTACTCGAGTACAATTTCACATTGCCACCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008173
VALIDATED
NR3C1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-792s21c1
Sequence:CCGGAGGATTGCAAGCCTCTTATTTCTCGAGAAATAAGAGGCTTGCAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-1925s21c1
Sequence:CCGGTTTGCTCCTGATCTGATTATTCTCGAGAATAATCAGATCAGGAGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-2280s21c1
Sequence:CCGGTGGATAAGTCCATGAGTATTGCTCGAGCAATACTCATGGACTTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-2119s21c1
Sequence:CCGGTGAGATTCGAATGACTTATATCTCGAGATATAAGTCATTCGAATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-2283s1c1
Sequence:CCGGCCCAGAGATGTTAGCTGAAATCTCGAGATTTCAGCTAACATCTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-1974s1c1
Sequence:CCGGGCTGTTTATCTCCACTGAATTCTCGAGAATTCAGTGGAGATAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008173.1-1660s1c1
Sequence:CCGGGAGGTGTTATATGCAGGATATCTCGAGATATCCTGCATATAACACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008173.1-265s1c1
Sequence:CCGGCCGCAGCCAGATTTATCCAAACTCGAGTTTGGATAAATCTGGCTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-4058s21c1
Sequence:CCGGTGTTGATGGATATCCTATAAGCTCGAGCTTATAGGATATCCATCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-821s1c1
Sequence:CCGGCTGGAGATACAATCTTATCAACTCGAGTTGATAAGATTGTATCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008173
VALIDATED
NR3C1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-792s21c1
Sequence:CCGGAGGATTGCAAGCCTCTTATTTCTCGAGAAATAAGAGGCTTGCAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-1925s21c1
Sequence:CCGGTTTGCTCCTGATCTGATTATTCTCGAGAATAATCAGATCAGGAGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-2280s21c1
Sequence:CCGGTGGATAAGTCCATGAGTATTGCTCGAGCAATACTCATGGACTTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-2119s21c1
Sequence:CCGGTGAGATTCGAATGACTTATATCTCGAGATATAAGTCATTCGAATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-2283s1c1
Sequence:CCGGCCCAGAGATGTTAGCTGAAATCTCGAGATTTCAGCTAACATCTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-1974s1c1
Sequence:CCGGGCTGTTTATCTCCACTGAATTCTCGAGAATTCAGTGGAGATAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008173.1-1660s1c1
Sequence:CCGGGAGGTGTTATATGCAGGATATCTCGAGATATCCTGCATATAACACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008173.1-265s1c1
Sequence:CCGGCCGCAGCCAGATTTATCCAAACTCGAGTTTGGATAAATCTGGCTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-4058s21c1
Sequence:CCGGTGTTGATGGATATCCTATAAGCTCGAGCTTATAGGATATCCATCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-821s1c1
Sequence:CCGGCTGGAGATACAATCTTATCAACTCGAGTTGATAAGATTGTATCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008173
VALIDATED
NR3C1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-792s21c1
Sequence:CCGGAGGATTGCAAGCCTCTTATTTCTCGAGAAATAAGAGGCTTGCAATCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-1925s21c1
Sequence:CCGGTTTGCTCCTGATCTGATTATTCTCGAGAATAATCAGATCAGGAGCAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-2280s21c1
Sequence:CCGGTGGATAAGTCCATGAGTATTGCTCGAGCAATACTCATGGACTTATCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-2119s21c1
Sequence:CCGGTGAGATTCGAATGACTTATATCTCGAGATATAAGTCATTCGAATCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-2283s1c1
Sequence:CCGGCCCAGAGATGTTAGCTGAAATCTCGAGATTTCAGCTAACATCTCTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-1974s1c1
Sequence:CCGGGCTGTTTATCTCCACTGAATTCTCGAGAATTCAGTGGAGATAAACAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008173.1-1660s1c1
Sequence:CCGGGAGGTGTTATATGCAGGATATCTCGAGATATCCTGCATATAACACCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008173.1-265s1c1
Sequence:CCGGCCGCAGCCAGATTTATCCAAACTCGAGTTTGGATAAATCTGGCTGCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238462    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008173.3-4058s21c1
Sequence:CCGGTGTTGATGGATATCCTATAAGCTCGAGCTTATAGGATATCCATCAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008173.1-821s1c1
Sequence:CCGGCTGGAGATACAATCTTATCAACTCGAGTTGATAAGATTGTATCTCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???