EMAIL THIS PAGE TO A FRIEND

NR3C2

nuclear receptor subfamily 3, group C, member 2

242 Gene Product Result for
Synonyms: MCR MLR MR NR3C2VIT
UniProtKB ID: P08235, B0ZBF5, Q2NKL1, Q96KQ8, Q96KQ9
Gene ID:
Human(4306) Summary: This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(110784) nuclear receptor subfamily 3, group C, member 2
Rat(25672) nuclear receptor subfamily 3, group C, member 2
Zebrafish(562171) nuclear receptor subfamily 3, group C, member 2
dog(475461) nuclear receptor subfamily 3, group C, member 2
cow(280861) nuclear receptor subfamily 3, group C, member 2
cow(537614) nuclear receptor subfamily 3, group C, member 2
Horse(100062570) nuclear receptor subfamily 3, group C, member 2
domestic cat(101081977) nuclear receptor subfamily 3, group C, member 2
chicken(374131) nuclear receptor subfamily 3, group C, member 2
sheep(101107046) nuclear receptor subfamily 3, group C, member 2
domestic guinea pig(100735309) nuclear receptor subfamily 3, group C, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000901 Rosetta Predictions human pricing
NM_013131 Rosetta Predictions rat pricing
NM_001083906 Rosetta Predictions mouse pricing
XM_899576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138964 predicted 2723
2 SASI_Hs01_00138965 predicted 1151
3 SASI_Hs01_00138968 predicted 714
4 SASI_Hs01_00138969 predicted 3029
5 SASI_Hs01_00138970 predicted 556
6 SASI_Hs02_00303466 predicted 674
7 SASI_Hs01_00138972 predicted 614
8 SASI_Hs02_00303467 predicted 1468
9 SASI_Hs01_00138973 predicted 1502
10 SASI_Hs02_00303468 predicted 2107
11 SASI_Hs01_00138966 predicted 3201
12 SASI_Hs01_00138967 predicted 606
13 SASI_Hs01_00138971 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115073 predicted 2818
2 SASI_Rn01_00115074 predicted 1772
3 SASI_Rn01_00115075 predicted 1862
4 SASI_Rn02_00260924 predicted 3052
5 SASI_Rn01_00115076 predicted 2125
6 SASI_Rn01_00115077 predicted 934
7 SASI_Rn01_00115078 predicted 2849
8 SASI_Rn02_00260925 predicted 817
9 SASI_Rn01_00115079 predicted 1642
10 SASI_Rn01_00115080 predicted 1251
11 SASI_Rn01_00115081 predicted 3090
12 SASI_Rn01_00115082 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299951 predicted 2374
2 SASI_Mm02_00299952 predicted 238
3 SASI_Mm02_00299953 predicted 1421
4 SASI_Mm02_00299954 predicted 1327
5 SASI_Mm02_00299955 predicted 2408
6 SASI_Mm02_00299956 predicted 1692
7 SASI_Mm02_00299957 predicted 2992
8 SASI_Mm02_00299958 predicted 814
9 SASI_Mm02_00299959 predicted 606
10 SASI_Mm02_00299960 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283784 predicted 3245
2 SASI_Mm01_00283785 predicted 1108
3 SASI_Mm01_00283786 predicted 2205
4 SASI_Mm01_00283787 predicted 3282
5 SASI_Mm01_00283788 predicted 2566
6 SASI_Mm01_00283789 predicted 3865
7 SASI_Mm01_00283790 predicted 1690
8 SASI_Mm01_00283791 predicted 1488
9 SASI_Mm01_00283792 predicted 1979
10 SASI_Mm01_00283793 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000901
VALIDATED
NR3C2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 3, group C, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000901.3-1504s21c1
Sequence:CCGGCCAGCTTAATATTGTCCAGTACTCGAGTACTGGACAATATTAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-1386s1c1
Sequence:CCGGCCAGCTTAATATTGTCCAGTACTCGAGTACTGGACAATATTAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000901.1-2566s1c1
Sequence:CCGGGCAAAGGTACTTCCAGGATTTCTCGAGAAATCCTGGAAGTACCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-604s1c1
Sequence:CCGGCCAGCTAAGATTTATCAGAATCTCGAGATTCTGATAAATCTTAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-2844s1c1
Sequence:CCGGGCTACTAAGCACAATTCCAAACTCGAGTTTGGAATTGTGCTTAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000901.3-548s21c1
Sequence:CCGGCCTTGCCTTCAGCAAGACAATCTCGAGATTGTCTTGCTGAAGGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000901.3-1795s21c1
Sequence:CCGGCGGATTCCCAGTGGGTATTAACTCGAGTTAATACCCACTGGGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000901.3-3679s21c1
Sequence:CCGGTACCCTTGGTTTGCACATAAACTCGAGTTTATGTGCAAACCAAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000901.3-807s21c1
Sequence:CCGGACACGCCCTTGAGATCATTTACTCGAGTAAATGATCTCAAGGGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000901
VALIDATED
NR3C2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 3, group C, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000901.3-1504s21c1
Sequence:CCGGCCAGCTTAATATTGTCCAGTACTCGAGTACTGGACAATATTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-1386s1c1
Sequence:CCGGCCAGCTTAATATTGTCCAGTACTCGAGTACTGGACAATATTAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000901.1-2566s1c1
Sequence:CCGGGCAAAGGTACTTCCAGGATTTCTCGAGAAATCCTGGAAGTACCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-604s1c1
Sequence:CCGGCCAGCTAAGATTTATCAGAATCTCGAGATTCTGATAAATCTTAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-2844s1c1
Sequence:CCGGGCTACTAAGCACAATTCCAAACTCGAGTTTGGAATTGTGCTTAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000901.3-548s21c1
Sequence:CCGGCCTTGCCTTCAGCAAGACAATCTCGAGATTGTCTTGCTGAAGGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000901.3-1795s21c1
Sequence:CCGGCGGATTCCCAGTGGGTATTAACTCGAGTTAATACCCACTGGGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000901.3-3679s21c1
Sequence:CCGGTACCCTTGGTTTGCACATAAACTCGAGTTTATGTGCAAACCAAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000901.3-807s21c1
Sequence:CCGGACACGCCCTTGAGATCATTTACTCGAGTAAATGATCTCAAGGGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000901
VALIDATED
NR3C2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 3, group C, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000901.3-1504s21c1
Sequence:CCGGCCAGCTTAATATTGTCCAGTACTCGAGTACTGGACAATATTAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-1386s1c1
Sequence:CCGGCCAGCTTAATATTGTCCAGTACTCGAGTACTGGACAATATTAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000901.1-2566s1c1
Sequence:CCGGGCAAAGGTACTTCCAGGATTTCTCGAGAAATCCTGGAAGTACCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-604s1c1
Sequence:CCGGCCAGCTAAGATTTATCAGAATCTCGAGATTCTGATAAATCTTAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000901.1-2844s1c1
Sequence:CCGGGCTACTAAGCACAATTCCAAACTCGAGTTTGGAATTGTGCTTAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000901.3-548s21c1
Sequence:CCGGCCTTGCCTTCAGCAAGACAATCTCGAGATTGTCTTGCTGAAGGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000901.3-1795s21c1
Sequence:CCGGCGGATTCCCAGTGGGTATTAACTCGAGTTAATACCCACTGGGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000901.3-3679s21c1
Sequence:CCGGTACCCTTGGTTTGCACATAAACTCGAGTTTATGTGCAAACCAAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000901.3-807s21c1
Sequence:CCGGACACGCCCTTGAGATCATTTACTCGAGTAAATGATCTCAAGGGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356093
NR3C2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 3, group C, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-1368s1c1
Sequence:CCGGCGGCAAATCTTAACAATTCAACTCGAGTTGAATTGTTAAGATTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-2808s1c1
Sequence:CCGGCCAAGGTACTTCCAGGATTTACTCGAGTAAATCCTGGAAGTACCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-1586s1c1
Sequence:CCGGCCTTTCCCTAAGACAGAGGAACTCGAGTTCCTCTGTCTTAGGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-2226s1c1
Sequence:CCGGGCTCTACTTTACGAAGTGTTTCTCGAGAAACACTTCGTAAAGTAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-780s1c1
Sequence:CCGGCCATGGGTTTATACATGGATTCTCGAGAATCCATGTATAAACCCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356093
NR3C2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 3, group C, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-1368s1c1
Sequence:CCGGCGGCAAATCTTAACAATTCAACTCGAGTTGAATTGTTAAGATTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-2808s1c1
Sequence:CCGGCCAAGGTACTTCCAGGATTTACTCGAGTAAATCCTGGAAGTACCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-1586s1c1
Sequence:CCGGCCTTTCCCTAAGACAGAGGAACTCGAGTTCCTCTGTCTTAGGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-2226s1c1
Sequence:CCGGGCTCTACTTTACGAAGTGTTTCTCGAGAAACACTTCGTAAAGTAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-780s1c1
Sequence:CCGGCCATGGGTTTATACATGGATTCTCGAGAATCCATGTATAAACCCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356093
NR3C2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 3, group C, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-1368s1c1
Sequence:CCGGCGGCAAATCTTAACAATTCAACTCGAGTTGAATTGTTAAGATTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-2808s1c1
Sequence:CCGGCCAAGGTACTTCCAGGATTTACTCGAGTAAATCCTGGAAGTACCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-1586s1c1
Sequence:CCGGCCTTTCCCTAAGACAGAGGAACTCGAGTTCCTCTGTCTTAGGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-2226s1c1
Sequence:CCGGGCTCTACTTTACGAAGTGTTTCTCGAGAAACACTTCGTAAAGTAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356093.1-780s1c1
Sequence:CCGGCCATGGGTTTATACATGGATTCTCGAGAATCCATGTATAAACCCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)