EMAIL THIS PAGE TO A FRIEND

NR5A1

nuclear receptor subfamily 5, group A, member 1

109 Gene Product Result for
Synonyms: AD4BP ELP FTZ1 FTZF1 POF7 SF-1 SF1 SPGF8 SRXY3
UniProtKB ID: Q13285, O15196, Q5T6F5
Gene ID:
Human(2516) Summary: The protein encoded by this gene is a transcriptional activator involved in sex determination. The encoded protein binds DNA as a monomer. Defects in this gene are a cause of XY sex reversal with or without adrenal failure as well as adrenocortical insufficiency without ovarian defect. [provided by RefSeq, Jul 2008]
Mouse(26423) nuclear receptor subfamily 5, group A, member 1
Rat(83826) nuclear receptor subfamily 5, group A, member 1
sheep(101113140) nuclear receptor subfamily 5, group A, member 1
sheep(443464) nuclear receptor subfamily 5, group A, member 1
naked mole-rat(101719136) nuclear receptor subfamily 5, group A, member 1
domestic guinea pig(100734721) nuclear receptor subfamily 5, group A, member 1
chicken(395960) nuclear receptor subfamily 5, group A, member 1
dog(609642) nuclear receptor subfamily 5, group A, member 1
domestic cat(101089155) nuclear receptor subfamily 5, group A, member 1
cow(281948) nuclear receptor subfamily 5, group A, member 1
Horse(100033902) nuclear receptor subfamily 5, group A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N7789 Anti-NR5A1 (111-125) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
N7914 Anti-NR5A1 (431-442) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32525 Anti-NR5A1 (AB1) antibody produced in rabbit IgG fraction of antiserum canine, mouse, guinea pig, bovine, rabbit, pig, horse, human, sheep, rat
western blot pricing
AV37471 Anti-NR5A1 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, canine, rat, bovine, pig, sheep, rabbit, human, horse, guinea pig
western blot pricing
AV45620 Anti-NR5A1 (AB3) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder pig, mouse, bovine, human, rat, canine
western blot pricing
AV31834 Anti-NR5A1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, bovine, horse, canine, human, mouse, pig
immunohistochemistry, western blot pricing
SAB2900140 Anti-NR5A1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2101651 Anti-NR5A1 antibody produced in rabbit affinity isolated antibody mouse, canine, bovine, guinea pig, sheep, horse, rat, rabbit, human, pig
western blot pricing
SAB2103942 Anti-NR5A1 antibody produced in rabbit affinity isolated antibody guinea pig, sheep, bovine, human, horse, canine, rabbit, pig
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004959 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142531 MISSION® esiRNA esiRNA human NR5A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004959 Rosetta Predictions human pricing
XM_001054966 Rosetta Predictions rat pricing
XM_001055033 Rosetta Predictions rat pricing
XM_001072865 Rosetta Predictions rat pricing
XM_001072904 Rosetta Predictions rat pricing
NM_139051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124447 predicted 1322
2 SASI_Hs01_00124448 predicted 994
3 SASI_Hs02_00338643 predicted 762
4 SASI_Hs01_00124449 predicted 765
5 SASI_Hs01_00124450 predicted 452
6 SASI_Hs01_00124451 predicted 1316
7 SASI_Hs01_00124452 predicted 513
8 SASI_Hs01_00124453 predicted 260
9 SASI_Hs01_00124454 predicted 316
10 SASI_Hs01_00124455 predicted 1981
11 SASI_Hs01_00124456 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277852 predicted 1099
2 SASI_Rn02_00277853 predicted 1213
3 SASI_Rn02_00277854 predicted 916
4 SASI_Rn02_00277855 predicted 1067
5 SASI_Rn02_00277856 predicted 490
6 SASI_Rn02_00277857 predicted 427
7 SASI_Rn02_00277858 predicted 595
8 SASI_Rn02_00277859 predicted 916
9 SASI_Rn02_00277860 predicted 1471
10 SASI_Rn02_00277861 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278152 predicted 1039
2 SASI_Rn02_00278153 predicted 1158
3 SASI_Rn02_00278154 predicted 863
4 SASI_Rn02_00278155 predicted 1009
5 SASI_Rn02_00278156 predicted 334
6 SASI_Rn02_00278157 predicted 433
7 SASI_Rn02_00278158 predicted 372
8 SASI_Rn02_00278159 predicted 538
9 SASI_Rn02_00278160 predicted 1415
10 SASI_Rn02_00278161 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340703 predicted 914
2 SASI_Rn02_00340704 predicted 1071
3 SASI_Rn02_00340705 predicted 383
4 SASI_Rn02_00340706 predicted 1950
5 SASI_Rn02_00340707 predicted 303
6 SASI_Rn02_00340708 predicted 1597
7 SASI_Rn02_00340709 predicted 2081
8 SASI_Rn02_00340710 predicted 2128
9 SASI_Rn02_00340711 predicted 798
10 SASI_Rn02_00340712 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340878 predicted 1040
2 SASI_Rn02_00340879 predicted 1163
3 SASI_Rn02_00340880 predicted 864
4 SASI_Rn02_00340881 predicted 1012
5 SASI_Rn02_00340882 predicted 327
6 SASI_Rn02_00340883 predicted 436
7 SASI_Rn02_00340884 predicted 372
8 SASI_Rn02_00340885 predicted 542
9 SASI_Rn02_00340886 predicted 858
10 SASI_Rn02_00340887 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031633 predicted 858
2 SASI_Mm01_00031635 predicted 1018
3 SASI_Mm01_00031636 predicted 327
4 SASI_Mm01_00031637 predicted 246
5 SASI_Mm01_00031638 predicted 1540
6 SASI_Mm01_00031639 predicted 1437
7 SASI_Mm01_00031640 predicted 742
8 SASI_Mm01_00031641 predicted 1306
9 SASI_Mm01_00031642 predicted 473
10 SASI_Mm02_00339863 predicted 529
11 SASI_Mm01_00031634 predicted 1976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139051
NR5A1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 5, group A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139051.2-2704s1c1
Sequence:CCGGCGCGTCAGATTTACAGCTTATCTCGAGATAAGCTGTAAATCTGACGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-288s1c1
Sequence:CCGGAGTCCAGAACAACAAGCATTACTCGAGTAATGCTTGTTGTTCTGGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-1308s1c1
Sequence:CCGGCGATGTGAAATTCCTGAACAACTCGAGTTGTTCAGGAATTTCACATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-1275s1c1
Sequence:CCGGCGTCTGTCTCAAGTTCCTCATCTCGAGATGAGGAACTTGAGACAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-739s1c1
Sequence:CCGGCGCACCATCAAGTCTGAGTATCTCGAGATACTCAGACTTGATGGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139051
NR5A1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 5, group A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139051.2-2704s1c1
Sequence:CCGGCGCGTCAGATTTACAGCTTATCTCGAGATAAGCTGTAAATCTGACGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-288s1c1
Sequence:CCGGAGTCCAGAACAACAAGCATTACTCGAGTAATGCTTGTTGTTCTGGACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-1308s1c1
Sequence:CCGGCGATGTGAAATTCCTGAACAACTCGAGTTGTTCAGGAATTTCACATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-1275s1c1
Sequence:CCGGCGTCTGTCTCAAGTTCCTCATCTCGAGATGAGGAACTTGAGACAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-739s1c1
Sequence:CCGGCGCACCATCAAGTCTGAGTATCTCGAGATACTCAGACTTGATGGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139051
NR5A1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 5, group A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139051.2-2704s1c1
Sequence:CCGGCGCGTCAGATTTACAGCTTATCTCGAGATAAGCTGTAAATCTGACGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-288s1c1
Sequence:CCGGAGTCCAGAACAACAAGCATTACTCGAGTAATGCTTGTTGTTCTGGACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-1308s1c1
Sequence:CCGGCGATGTGAAATTCCTGAACAACTCGAGTTGTTCAGGAATTTCACATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-1275s1c1
Sequence:CCGGCGTCTGTCTCAAGTTCCTCATCTCGAGATGAGGAACTTGAGACAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139051.2-739s1c1
Sequence:CCGGCGCACCATCAAGTCTGAGTATCTCGAGATACTCAGACTTGATGGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004959
NR5A1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 5, group A, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-337s1c1
Sequence:CCGGCGAGAGCCAGAGCTGCAAGATCTCGAGATCTTGCAGCTCTGGCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-1543s1c1
Sequence:CCGGCATCGAAATGCTGCAAGCCAACTCGAGTTGGCTTGCAGCATTTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-460s1c1
Sequence:CCGGCCGGAACAAGTTTGGGCCGATCTCGAGATCGGCCCAAACTTGTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-506s1c1
Sequence:CCGGCAGCAGAAGAAGGCACAGATTCTCGAGAATCTGTGCCTTCTTCTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-1321s1c1
Sequence:CCGGCCTGGATTTGAAGTTCCTGAACTCGAGTTCAGGAACTTCAAATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004959.4-1027s21c1
Sequence:CCGGACGCAGGTGCATGGTCTTCAACTCGAGTTGAAGACCATGCACCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004959.4-1984s21c1
Sequence:CCGGGAGAAGTTGAGCAGGTATCAACTCGAGTTGATACCTGCTCAACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004959.4-1104s21c1
Sequence:CCGGTGGTGTTCGACCACATCTACCCTCGAGGGTAGATGTGGTCGAACACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004959
NR5A1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 5, group A, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-337s1c1
Sequence:CCGGCGAGAGCCAGAGCTGCAAGATCTCGAGATCTTGCAGCTCTGGCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-1543s1c1
Sequence:CCGGCATCGAAATGCTGCAAGCCAACTCGAGTTGGCTTGCAGCATTTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-460s1c1
Sequence:CCGGCCGGAACAAGTTTGGGCCGATCTCGAGATCGGCCCAAACTTGTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-506s1c1
Sequence:CCGGCAGCAGAAGAAGGCACAGATTCTCGAGAATCTGTGCCTTCTTCTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-1321s1c1
Sequence:CCGGCCTGGATTTGAAGTTCCTGAACTCGAGTTCAGGAACTTCAAATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004959.4-1027s21c1
Sequence:CCGGACGCAGGTGCATGGTCTTCAACTCGAGTTGAAGACCATGCACCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004959.4-1984s21c1
Sequence:CCGGGAGAAGTTGAGCAGGTATCAACTCGAGTTGATACCTGCTCAACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004959.4-1104s21c1
Sequence:CCGGTGGTGTTCGACCACATCTACCCTCGAGGGTAGATGTGGTCGAACACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004959
NR5A1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 5, group A, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-337s1c1
Sequence:CCGGCGAGAGCCAGAGCTGCAAGATCTCGAGATCTTGCAGCTCTGGCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-1543s1c1
Sequence:CCGGCATCGAAATGCTGCAAGCCAACTCGAGTTGGCTTGCAGCATTTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-460s1c1
Sequence:CCGGCCGGAACAAGTTTGGGCCGATCTCGAGATCGGCCCAAACTTGTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-506s1c1
Sequence:CCGGCAGCAGAAGAAGGCACAGATTCTCGAGAATCTGTGCCTTCTTCTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004959.3-1321s1c1
Sequence:CCGGCCTGGATTTGAAGTTCCTGAACTCGAGTTCAGGAACTTCAAATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004959.4-1027s21c1
Sequence:CCGGACGCAGGTGCATGGTCTTCAACTCGAGTTGAAGACCATGCACCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004959.4-1984s21c1
Sequence:CCGGGAGAAGTTGAGCAGGTATCAACTCGAGTTGATACCTGCTCAACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004959.4-1104s21c1
Sequence:CCGGTGGTGTTCGACCACATCTACCCTCGAGGGTAGATGTGGTCGAACACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)