EMAIL THIS PAGE TO A FRIEND

NR5A2

nuclear receptor subfamily 5, group A, member 2

203 Gene Product Result for
Synonyms: B1F B1F2 CPF FTF FTZ-F1 FTZ-F1beta LRH-1 LRH1 hB1F-2
UniProtKB ID: O00482, O95642, Q147U3
Gene ID:
Mouse(26424) nuclear receptor subfamily 5, group A, member 2
Rat(60349) nuclear receptor subfamily 5, group A, member 2
Zebrafish(30749) nuclear receptor subfamily 5, group A, member 2
cow(541305) nuclear receptor subfamily 5, group A, member 2
Horse(100009700) nuclear receptor subfamily 5, group A, member 2
domestic cat(101094231) nuclear receptor subfamily 5, group A, member 2
dog(490252) nuclear receptor subfamily 5, group A, member 2
chicken(395961) nuclear receptor subfamily 5, group A, member 2
domestic guinea pig(100730011) nuclear receptor subfamily 5, group A, member 2
naked mole-rat(101708841) nuclear receptor subfamily 5, group A, member 2
Domestic Rabbit(100008896) nuclear receptor subfamily 5, group A, member 2
sheep(100653388) nuclear receptor subfamily 5, group A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003822 Rosetta Predictions human pricing
NM_205860 Rosetta Predictions human pricing
NM_021742 Rosetta Predictions rat pricing
NM_030676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061211 predicted 528
2 SASI_Hs01_00061212 predicted 1232
3 SASI_Hs01_00061214 predicted 558
4 SASI_Hs02_00336370 predicted 1426
5 SASI_Hs01_00061215 predicted 916
6 SASI_Hs01_00061216 predicted 1149
7 SASI_Hs01_00061217 predicted 915
8 SASI_Hs01_00061218 predicted 1643
9 SASI_Hs01_00061219 predicted 1645
10 SASI_Hs02_00336371 predicted 762
11 SASI_Hs01_00061210 predicted 501
12 SASI_Hs01_00061213 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027847 predicted 664
2 SASI_Hs01_00027848 predicted 1375
3 SASI_Hs01_00027850 predicted 692
4 SASI_Hs02_00373500 predicted 1562
5 SASI_Hs01_00027851 predicted 1058
6 SASI_Hs01_00027852 predicted 1288
7 SASI_Hs01_00027853 predicted 1046
8 SASI_Hs01_00027854 predicted 1778
9 SASI_Hs01_00027855 predicted 1779
10 SASI_Hs02_00373501 predicted 907
11 SASI_Hs01_00027846 predicted 647
12 SASI_Hs01_00027849 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262771 predicted 1049
2 SASI_Rn01_00048698 predicted 1388
3 SASI_Rn01_00048699 predicted 346
4 SASI_Rn01_00048700 predicted 1505
5 SASI_Rn01_00048701 predicted 921
6 SASI_Rn01_00048702 predicted 1033
7 SASI_Rn01_00048703 predicted 701
8 SASI_Rn01_00048704 predicted 1312
9 SASI_Rn01_00048705 predicted 588
10 SASI_Rn01_00048706 predicted 1301
11 SASI_Rn01_00048707 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088910 predicted 1363
2 SASI_Mm01_00088911 predicted 1924
3 SASI_Mm01_00088912 predicted 414
4 SASI_Mm01_00088913 predicted 648
5 SASI_Mm01_00088914 predicted 1794
6 SASI_Mm01_00088915 predicted 1748
7 SASI_Mm01_00088916 predicted 979
8 SASI_Mm01_00088917 predicted 591
9 SASI_Mm01_00088918 predicted 660
10 SASI_Mm01_00088919 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003822
VALIDATED
NR5A2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 5, group A, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-476s21c1
Sequence:CCGGGCGTTGTCCTTACTGTCGTTTCTCGAGAAACGACAGTAAGGACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1511s1c1
Sequence:CCGGGCTGGACTACACAATGTGTAACTCGAGTTACACATTGTGTAGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003822.3-476s1c1
Sequence:CCGGGCGTTGTCCTTACTGTCGTTTCTCGAGAAACGACAGTAAGGACAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-1511s21c1
Sequence:CCGGGCTGGACTACACAATGTGTAACTCGAGTTACACATTGTGTAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-1616s21c1
Sequence:CCGGCCTCTACTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1616s1c1
Sequence:CCGGCCTCTACTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1433s1c1
Sequence:CCGGGCTCTTTAGTTTAGATGTCAACTCGAGTTGACATCTAAACTAAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003822.3-910s1c1
Sequence:CCGGCCGAGTCCATAATGGGCTATTCTCGAGAATAGCCCATTATGGACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-910s21c1
Sequence:CCGGCCGAGTCCATAATGGGCTATTCTCGAGAATAGCCCATTATGGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003822
VALIDATED
NR5A2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 5, group A, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-476s21c1
Sequence:CCGGGCGTTGTCCTTACTGTCGTTTCTCGAGAAACGACAGTAAGGACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1511s1c1
Sequence:CCGGGCTGGACTACACAATGTGTAACTCGAGTTACACATTGTGTAGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003822.3-476s1c1
Sequence:CCGGGCGTTGTCCTTACTGTCGTTTCTCGAGAAACGACAGTAAGGACAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-1511s21c1
Sequence:CCGGGCTGGACTACACAATGTGTAACTCGAGTTACACATTGTGTAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-1616s21c1
Sequence:CCGGCCTCTACTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1616s1c1
Sequence:CCGGCCTCTACTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1433s1c1
Sequence:CCGGGCTCTTTAGTTTAGATGTCAACTCGAGTTGACATCTAAACTAAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003822.3-910s1c1
Sequence:CCGGCCGAGTCCATAATGGGCTATTCTCGAGAATAGCCCATTATGGACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-910s21c1
Sequence:CCGGCCGAGTCCATAATGGGCTATTCTCGAGAATAGCCCATTATGGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003822
VALIDATED
NR5A2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 5, group A, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-476s21c1
Sequence:CCGGGCGTTGTCCTTACTGTCGTTTCTCGAGAAACGACAGTAAGGACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1511s1c1
Sequence:CCGGGCTGGACTACACAATGTGTAACTCGAGTTACACATTGTGTAGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003822.3-476s1c1
Sequence:CCGGGCGTTGTCCTTACTGTCGTTTCTCGAGAAACGACAGTAAGGACAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-1511s21c1
Sequence:CCGGGCTGGACTACACAATGTGTAACTCGAGTTACACATTGTGTAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-1616s21c1
Sequence:CCGGCCTCTACTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1616s1c1
Sequence:CCGGCCTCTACTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003822.3-1433s1c1
Sequence:CCGGGCTCTTTAGTTTAGATGTCAACTCGAGTTGACATCTAAACTAAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003822.3-910s1c1
Sequence:CCGGCCGAGTCCATAATGGGCTATTCTCGAGAATAGCCCATTATGGACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003822.3-910s21c1
Sequence:CCGGCCGAGTCCATAATGGGCTATTCTCGAGAATAGCCCATTATGGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030676
NR5A2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 5, group A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1794s1c1
Sequence:CCGGCCCTATAATAACCTCCTCATTCTCGAGAATGAGGAGGTTATTATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1550s1c1
Sequence:CCGGGCGGGAGTTTGTATGTCTCAACTCGAGTTGAGACATACAAACTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1682s1c1
Sequence:CCGGCCCACAACAGACTGAGAAATTCTCGAGAATTTCTCAGTCTGTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1752s1c1
Sequence:CCGGGCAGAAGACTACCTGTACTATCTCGAGATAGTACAGGTAGTCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1160s1c1
Sequence:CCGGGCCTCAAGTTCAAGCGAAGATCTCGAGATCTTCGCTTGAACTTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030676
NR5A2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 5, group A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1794s1c1
Sequence:CCGGCCCTATAATAACCTCCTCATTCTCGAGAATGAGGAGGTTATTATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1550s1c1
Sequence:CCGGGCGGGAGTTTGTATGTCTCAACTCGAGTTGAGACATACAAACTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1682s1c1
Sequence:CCGGCCCACAACAGACTGAGAAATTCTCGAGAATTTCTCAGTCTGTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1752s1c1
Sequence:CCGGGCAGAAGACTACCTGTACTATCTCGAGATAGTACAGGTAGTCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1160s1c1
Sequence:CCGGGCCTCAAGTTCAAGCGAAGATCTCGAGATCTTCGCTTGAACTTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030676
NR5A2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 5, group A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1794s1c1
Sequence:CCGGCCCTATAATAACCTCCTCATTCTCGAGAATGAGGAGGTTATTATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1550s1c1
Sequence:CCGGGCGGGAGTTTGTATGTCTCAACTCGAGTTGAGACATACAAACTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1682s1c1
Sequence:CCGGCCCACAACAGACTGAGAAATTCTCGAGAATTTCTCAGTCTGTTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1752s1c1
Sequence:CCGGGCAGAAGACTACCTGTACTATCTCGAGATAGTACAGGTAGTCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030676.1-1160s1c1
Sequence:CCGGGCCTCAAGTTCAAGCGAAGATCTCGAGATCTTCGCTTGAACTTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)