EMAIL THIS PAGE TO A FRIEND

NRAP

nebulin-related anchoring protein

91 Gene Product Result for
Synonyms: N-RAP
Gene ID:
Mouse(18175) nebulin-related anchoring protein
Rat(307982) nebulin-related anchoring protein
Zebrafish(553314) NRAP protein
chicken(423899) nebulin-related anchoring protein
dog(477823) nebulin-related anchoring protein
Horse(100059106) nebulin-related anchoring protein
cow(532640) nebulin-related anchoring protein
domestic cat(101080920) nebulin-related anchoring protein
sheep(101122236) nebulin-related anchoring protein
domestic guinea pig(100728447) nebulin-related anchoring protein
naked mole-rat(101712913) nebulin-related anchoring protein
Domestic Rabbit(100358638) nebulin-related anchoring protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006175 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071771 MISSION® esiRNA esiRNA human NRAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006175 Rosetta Predictions human pricing
NM_198060 Rosetta Predictions human pricing
NM_001107443 Rosetta Predictions rat pricing
NM_001113743 Rosetta Predictions rat pricing
NM_008733 Rosetta Predictions mouse pricing
NM_198059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059426 predicted 1585
2 SASI_Hs01_00059427 predicted 2746
3 SASI_Hs01_00059428 predicted 3748
4 SASI_Hs01_00059429 predicted 920
5 SASI_Hs01_00059430 predicted 4568
6 SASI_Hs01_00059431 predicted 3173
7 SASI_Hs01_00059432 predicted 2713
8 SASI_Hs01_00059433 predicted 3783
9 SASI_Hs02_00341034 predicted 608
10 SASI_Hs01_00059435 predicted 874
11 SASI_Hs01_00059434 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180597 predicted 1691
2 SASI_Hs01_00180598 predicted 2850
3 SASI_Hs01_00180599 predicted 3856
4 SASI_Hs01_00180600 predicted 924
5 SASI_Hs01_00180601 predicted 4667
6 SASI_Hs01_00180602 predicted 3278
7 SASI_Hs01_00180603 predicted 2818
8 SASI_Hs01_00180604 predicted 3881
9 SASI_Hs02_00371617 predicted 607
10 SASI_Hs02_00371618 predicted 875
11 SASI_Hs01_00180605 predicted 482
12 SASI_Hs01_00180606 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228875 predicted 2478
2 SASI_Rn02_00228876 predicted 3507
3 SASI_Rn02_00228877 predicted 4557
4 SASI_Rn02_00228878 predicted 4395
5 SASI_Rn02_00228879 predicted 928
6 SASI_Rn02_00228880 predicted 2932
7 SASI_Rn02_00228881 predicted 1760
8 SASI_Rn02_00228882 predicted 3513
9 SASI_Rn02_00228883 predicted 1493
10 SASI_Rn02_00228884 predicted 3879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251923 predicted 2587
2 SASI_Rn02_00251924 predicted 3605
3 SASI_Rn02_00251925 predicted 4661
4 SASI_Rn02_00251926 predicted 4497
5 SASI_Rn02_00251927 predicted 935
6 SASI_Rn02_00251928 predicted 3034
7 SASI_Rn02_00251929 predicted 1868
8 SASI_Rn02_00251930 predicted 3612
9 SASI_Rn02_00251931 predicted 1590
10 SASI_Rn02_00251932 predicted 3984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116052 predicted 2549
2 SASI_Mm02_00314585 predicted 3840
3 SASI_Mm02_00314586 predicted 413
4 SASI_Mm01_00116054 predicted 939
5 SASI_Mm02_00314587 predicted 876
6 SASI_Mm02_00314588 predicted 509
7 SASI_Mm02_00314589 predicted 4504
8 SASI_Mm02_00314590 predicted 3036
9 SASI_Mm02_00314591 predicted 4772
10 SASI_Mm01_00116061 predicted 1035
11 SASI_Mm01_00116053 predicted 4176
12 SASI_Mm01_00116055 predicted 4064
13 SASI_Mm01_00116056 predicted 3979
14 SASI_Mm01_00116057 predicted 4901
15 SASI_Mm01_00116058 predicted 5054
16 SASI_Mm01_00116059 predicted 4045
17 SASI_Mm01_00116060 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060260 predicted 2445
2 SASI_Mm02_00350796 predicted 3732
3 SASI_Mm02_00350797 predicted 419
4 SASI_Mm01_00060262 predicted 938
5 SASI_Mm02_00350798 predicted 877
6 SASI_Mm02_00350799 predicted 504
7 SASI_Mm02_00350800 predicted 4395
8 SASI_Mm02_00350801 predicted 2939
9 SASI_Mm02_00350802 predicted 4668
10 SASI_Mm01_00060269 predicted 1031
11 SASI_Mm01_00060261 predicted 4065
12 SASI_Mm01_00060263 predicted 3956
13 SASI_Mm01_00060264 predicted 3875
14 SASI_Mm01_00060265 predicted 4801
15 SASI_Mm01_00060266 predicted 4953
16 SASI_Mm01_00060267 predicted 3947
17 SASI_Mm01_00060268 predicted 1471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008733
NRAP MISSION shRNA Bacterial Glycerol Stock
nebulin-related anchoring protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-891s1c1
Sequence:CCGGCCAGCTTATCAGATAGCCAAACTCGAGTTTGGCTATCTGATAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-1697s1c1
Sequence:CCGGCGAGAGAAACAAGCTGAACTACTCGAGTAGTTCAGCTTGTTTCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-3630s1c1
Sequence:CCGGCGCAAGTTACAGAGTGAGAATCTCGAGATTCTCACTCTGTAACTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-3048s1c1
Sequence:CCGGGCTTTGAAGTTTACCAGTATTCTCGAGAATACTGGTAAACTTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-4785s1c1
Sequence:CCGGGCCAGTGATTTCCGGTACAAACTCGAGTTTGTACCGGAAATCACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-1876s21c1
Sequence:CCGGAGCTTGCTAGCAGCGTTAAATCTCGAGATTTAACGCTGCTAGCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-3219s21c1
Sequence:CCGGATCAGCGAGACTCGCTATAAGCTCGAGCTTATAGCGAGTCTCGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-356s21c1
Sequence:CCGGCGTCTACCACACACCCTTAAACTCGAGTTTAAGGGTGTGTGGTAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-3738s21c1
Sequence:CCGGGAGCTCATCAGCGAGAGTAAACTCGAGTTTACTCTCGCTGATGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008733
NRAP MISSION shRNA shRNA Plasmid DNA
nebulin-related anchoring protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-891s1c1
Sequence:CCGGCCAGCTTATCAGATAGCCAAACTCGAGTTTGGCTATCTGATAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-1697s1c1
Sequence:CCGGCGAGAGAAACAAGCTGAACTACTCGAGTAGTTCAGCTTGTTTCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-3630s1c1
Sequence:CCGGCGCAAGTTACAGAGTGAGAATCTCGAGATTCTCACTCTGTAACTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-3048s1c1
Sequence:CCGGGCTTTGAAGTTTACCAGTATTCTCGAGAATACTGGTAAACTTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-4785s1c1
Sequence:CCGGGCCAGTGATTTCCGGTACAAACTCGAGTTTGTACCGGAAATCACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-1876s21c1
Sequence:CCGGAGCTTGCTAGCAGCGTTAAATCTCGAGATTTAACGCTGCTAGCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-3219s21c1
Sequence:CCGGATCAGCGAGACTCGCTATAAGCTCGAGCTTATAGCGAGTCTCGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-356s21c1
Sequence:CCGGCGTCTACCACACACCCTTAAACTCGAGTTTAAGGGTGTGTGGTAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-3738s21c1
Sequence:CCGGGAGCTCATCAGCGAGAGTAAACTCGAGTTTACTCTCGCTGATGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008733
NRAP MISSION shRNA Lentiviral Transduction Particles
nebulin-related anchoring protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-891s1c1
Sequence:CCGGCCAGCTTATCAGATAGCCAAACTCGAGTTTGGCTATCTGATAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-1697s1c1
Sequence:CCGGCGAGAGAAACAAGCTGAACTACTCGAGTAGTTCAGCTTGTTTCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-3630s1c1
Sequence:CCGGCGCAAGTTACAGAGTGAGAATCTCGAGATTCTCACTCTGTAACTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-3048s1c1
Sequence:CCGGGCTTTGAAGTTTACCAGTATTCTCGAGAATACTGGTAAACTTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008733.2-4785s1c1
Sequence:CCGGGCCAGTGATTTCCGGTACAAACTCGAGTTTGTACCGGAAATCACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-1876s21c1
Sequence:CCGGAGCTTGCTAGCAGCGTTAAATCTCGAGATTTAACGCTGCTAGCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-3219s21c1
Sequence:CCGGATCAGCGAGACTCGCTATAAGCTCGAGCTTATAGCGAGTCTCGCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-356s21c1
Sequence:CCGGCGTCTACCACACACCCTTAAACTCGAGTTTAAGGGTGTGTGGTAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008733.3-3738s21c1
Sequence:CCGGGAGCTCATCAGCGAGAGTAAACTCGAGTTTACTCTCGCTGATGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006175
NRAP MISSION shRNA Bacterial Glycerol Stock
nebulin-related anchoring protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-4583s1c1
Sequence:CCGGGCATCTGAGTGACAAAGTCTACTCGAGTAGACTTTGTCACTCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-2517s1c1
Sequence:CCGGGTGAAGTACAAGGAGGATTATCTCGAGATAATCCTCCTTGTACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-3576s1c1
Sequence:CCGGCTGAACTTTATGCGAGGTGTTCTCGAGAACACCTCGCATAAAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-585s1c1
Sequence:CCGGCCCGAAATTGTAAGGATGGTTCTCGAGAACCATCCTTACAATTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006175.3-358s1c1
Sequence:CCGGCCAGTGTCTATCACACTCCATCTCGAGATGGAGTGTGATAGACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006175.3-1542s1c1
Sequence:CCGGCCACAGATTGTTCAAGCCAAACTCGAGTTTGGCTTGAACAATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006175
NRAP MISSION shRNA shRNA Plasmid DNA
nebulin-related anchoring protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-4583s1c1
Sequence:CCGGGCATCTGAGTGACAAAGTCTACTCGAGTAGACTTTGTCACTCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-2517s1c1
Sequence:CCGGGTGAAGTACAAGGAGGATTATCTCGAGATAATCCTCCTTGTACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-3576s1c1
Sequence:CCGGCTGAACTTTATGCGAGGTGTTCTCGAGAACACCTCGCATAAAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-585s1c1
Sequence:CCGGCCCGAAATTGTAAGGATGGTTCTCGAGAACCATCCTTACAATTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006175.3-358s1c1
Sequence:CCGGCCAGTGTCTATCACACTCCATCTCGAGATGGAGTGTGATAGACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006175.3-1542s1c1
Sequence:CCGGCCACAGATTGTTCAAGCCAAACTCGAGTTTGGCTTGAACAATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006175
NRAP MISSION shRNA Lentiviral Transduction Particles
nebulin-related anchoring protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-4583s1c1
Sequence:CCGGGCATCTGAGTGACAAAGTCTACTCGAGTAGACTTTGTCACTCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-2517s1c1
Sequence:CCGGGTGAAGTACAAGGAGGATTATCTCGAGATAATCCTCCTTGTACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-3576s1c1
Sequence:CCGGCTGAACTTTATGCGAGGTGTTCTCGAGAACACCTCGCATAAAGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006175.3-585s1c1
Sequence:CCGGCCCGAAATTGTAAGGATGGTTCTCGAGAACCATCCTTACAATTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006175.3-358s1c1
Sequence:CCGGCCAGTGTCTATCACACTCCATCTCGAGATGGAGTGTGATAGACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006175.3-1542s1c1
Sequence:CCGGCCACAGATTGTTCAAGCCAAACTCGAGTTTGGCTTGAACAATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)