EMAIL THIS PAGE TO A FRIEND

NRARP

NOTCH-regulated ankyrin repeat protein

71 Gene Product Result for
UniProtKB ID: Q7Z6K4, B8A4K5
Gene ID:
Mouse(67122) Notch-regulated ankyrin repeat protein
Rat(499745) Notch-regulated ankyrin repeat protein
naked mole-rat(101710325) NOTCH-regulated ankyrin repeat protein
chicken(431400) NOTCH-regulated ankyrin repeat protein
cow(100299743) NOTCH-regulated ankyrin repeat protein
dog(100683070) NOTCH-regulated ankyrin repeat protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA025729 Anti-NRARP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104114 Anti-NRARP antibody produced in rabbit affinity isolated antibody zebrafish, mouse, human, canine, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004354 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203911 MISSION® esiRNA esiRNA targeting mouse Nrarp mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004354 Rosetta Predictions human pricing
XM_575080 Rosetta Predictions rat pricing
NM_025980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304574 predicted 570
2 SASI_Hs01_00217939 predicted 613
3 SASI_Hs02_00304575 predicted 570
4 SASI_Hs01_00217940 predicted 593
5 SASI_Hs01_00217941 predicted 657
6 SASI_Hs01_00217942 predicted 592
7 SASI_Hs01_00217944 predicted 599
8 SASI_Hs01_00217943 predicted 552
9 SASI_Hs01_00217945 predicted 984
10 SASI_Hs01_00217946 predicted 507
11 SASI_Hs01_00217947 predicted 1257
12 SASI_Hs01_00217948 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403025 predicted 802
2 SASI_Rn02_00403026 predicted 769
3 SASI_Rn02_00403027 predicted 576
4 SASI_Rn02_00403028 predicted 1022
5 SASI_Rn02_00403029 predicted 548
6 SASI_Rn02_00403030 predicted 636
7 SASI_Rn02_00403031 predicted 1151
8 SASI_Rn02_00403032 predicted 516
9 SASI_Rn02_00403033 predicted 851
10 SASI_Rn02_00403034 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084134 predicted 801
2 SASI_Mm01_00084139 predicted 771
3 SASI_Mm01_00084132 predicted 571
4 SASI_Mm01_00084131 predicted 1014
5 SASI_Mm01_00084135 predicted 635
6 SASI_Mm02_00329412 predicted 1165
7 SASI_Mm01_00084138 predicted 851
8 SASI_Mm01_00084140 predicted 732
9 SASI_Mm02_00329413 predicted 514
10 SASI_Mm02_00329414 predicted 378
11 SASI_Mm01_00084133 predicted 1032
12 SASI_Mm01_00084136 predicted 994
13 SASI_Mm01_00084137 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025980
NRARP MISSION shRNA Bacterial Glycerol Stock
NOTCH-regulated ankyrin repeat protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-550s21c1
Sequence:CCGGTGGTGAAGCTGTTGGTCAAGTCTCGAGACTTGACCAACAGCTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025980.2-1008s21c1
Sequence:CCGGGACTTCGGAATCCCGAGATACCTCGAGGTATCTCGGGATTCCGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-611s21c1
Sequence:CCGGCGCGCTACACATCGCCGCTTTCTCGAGAAAGCGGCGATGTGTAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-458s21c1
Sequence:CCGGGAACATGACTAACTGCGAATTCTCGAGAATTCGCAGTTAGTCATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-640s21c1
Sequence:CCGGACCAGGACATCGTGCTCTATCCTCGAGGATAGAGCACGATGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025980.1-1354s1c1
Sequence:CCGGCCCTTCCTAGTGACTTCTATTCTCGAGAATAGAAGTCACTAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-256s1c1
Sequence:CCGGCCAGTCAGTCATCGACGGCAACTCGAGTTGCCGTCGATGACTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-346s1c1
Sequence:CCGGCGCGCTACACATCGCCGCTTTCTCGAGAAAGCGGCGATGTGTAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-196s1c1
Sequence:CCGGCATGACTAACTGCGAATTCAACTCGAGTTGAATTCGCAGTTAGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-193s1c1
Sequence:CCGGGAACATGACTAACTGCGAATTCTCGAGAATTCGCAGTTAGTCATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025980
NRARP MISSION shRNA shRNA Plasmid DNA
NOTCH-regulated ankyrin repeat protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-550s21c1
Sequence:CCGGTGGTGAAGCTGTTGGTCAAGTCTCGAGACTTGACCAACAGCTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025980.2-1008s21c1
Sequence:CCGGGACTTCGGAATCCCGAGATACCTCGAGGTATCTCGGGATTCCGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-611s21c1
Sequence:CCGGCGCGCTACACATCGCCGCTTTCTCGAGAAAGCGGCGATGTGTAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-458s21c1
Sequence:CCGGGAACATGACTAACTGCGAATTCTCGAGAATTCGCAGTTAGTCATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-640s21c1
Sequence:CCGGACCAGGACATCGTGCTCTATCCTCGAGGATAGAGCACGATGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025980.1-1354s1c1
Sequence:CCGGCCCTTCCTAGTGACTTCTATTCTCGAGAATAGAAGTCACTAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-256s1c1
Sequence:CCGGCCAGTCAGTCATCGACGGCAACTCGAGTTGCCGTCGATGACTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-346s1c1
Sequence:CCGGCGCGCTACACATCGCCGCTTTCTCGAGAAAGCGGCGATGTGTAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-196s1c1
Sequence:CCGGCATGACTAACTGCGAATTCAACTCGAGTTGAATTCGCAGTTAGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-193s1c1
Sequence:CCGGGAACATGACTAACTGCGAATTCTCGAGAATTCGCAGTTAGTCATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025980
NRARP MISSION shRNA Lentiviral Transduction Particles
NOTCH-regulated ankyrin repeat protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-550s21c1
Sequence:CCGGTGGTGAAGCTGTTGGTCAAGTCTCGAGACTTGACCAACAGCTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025980.2-1008s21c1
Sequence:CCGGGACTTCGGAATCCCGAGATACCTCGAGGTATCTCGGGATTCCGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-611s21c1
Sequence:CCGGCGCGCTACACATCGCCGCTTTCTCGAGAAAGCGGCGATGTGTAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-458s21c1
Sequence:CCGGGAACATGACTAACTGCGAATTCTCGAGAATTCGCAGTTAGTCATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025980.2-640s21c1
Sequence:CCGGACCAGGACATCGTGCTCTATCCTCGAGGATAGAGCACGATGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025980.1-1354s1c1
Sequence:CCGGCCCTTCCTAGTGACTTCTATTCTCGAGAATAGAAGTCACTAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-256s1c1
Sequence:CCGGCCAGTCAGTCATCGACGGCAACTCGAGTTGCCGTCGATGACTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-346s1c1
Sequence:CCGGCGCGCTACACATCGCCGCTTTCTCGAGAAAGCGGCGATGTGTAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-196s1c1
Sequence:CCGGCATGACTAACTGCGAATTCAACTCGAGTTGAATTCGCAGTTAGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025980.1-193s1c1
Sequence:CCGGGAACATGACTAACTGCGAATTCTCGAGAATTCGCAGTTAGTCATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004354
VALIDATED
NRARP MISSION shRNA Bacterial Glycerol Stock
NOTCH-regulated ankyrin repeat protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001004354.1-626s1c1
Sequence:CCGGCTATCTCATCACCAAGGCGAACTCGAGTTCGCCTTGGTGATGAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004354.1-437s1c1
Sequence:CCGGCAACTGCGAGTTCAACGTGAACTCGAGTTCACGTTGAACTCGCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001004354.1-979s1c1
Sequence:CCGGCAAGTTCGGAATCCCGAGATACTCGAGTATCTCGGGATTCCGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004354.1-1486s1c1
Sequence:CCGGCTCCCTCAAATCCGTGAGTTTCTCGAGAAACTCACGGATTTGAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004354.1-428s1c1
Sequence:CCGGGAACATGACCAACTGCGAGTTCTCGAGAACTCGCAGTTGGTCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004354.1-620s1c1
Sequence:CCGGCGTGCTCTATCTCATCACCAACTCGAGTTGGTGATGAGATAGAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004354.1-443s1c1
Sequence:CCGGCGAGTTCAACGTGAACTCGTTCTCGAGAACGAGTTCACGTTGAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001004354.1-1362s1c1
Sequence:CCGGCCATTTCTTGGTTGCACTGAACTCGAGTTCAGTGCAACCAAGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004354.1-1239s1c1
Sequence:CCGGGTACATTTGTGGGTGGAGTTTCTCGAGAAACTCCACCCACAAATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004354
VALIDATED
NRARP MISSION shRNA shRNA Plasmid DNA
NOTCH-regulated ankyrin repeat protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001004354.1-626s1c1
Sequence:CCGGCTATCTCATCACCAAGGCGAACTCGAGTTCGCCTTGGTGATGAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004354.1-437s1c1
Sequence:CCGGCAACTGCGAGTTCAACGTGAACTCGAGTTCACGTTGAACTCGCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001004354.1-979s1c1
Sequence:CCGGCAAGTTCGGAATCCCGAGATACTCGAGTATCTCGGGATTCCGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004354.1-1486s1c1
Sequence:CCGGCTCCCTCAAATCCGTGAGTTTCTCGAGAAACTCACGGATTTGAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004354.1-428s1c1
Sequence:CCGGGAACATGACCAACTGCGAGTTCTCGAGAACTCGCAGTTGGTCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004354.1-620s1c1
Sequence:CCGGCGTGCTCTATCTCATCACCAACTCGAGTTGGTGATGAGATAGAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004354.1-443s1c1
Sequence:CCGGCGAGTTCAACGTGAACTCGTTCTCGAGAACGAGTTCACGTTGAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001004354.1-1362s1c1
Sequence:CCGGCCATTTCTTGGTTGCACTGAACTCGAGTTCAGTGCAACCAAGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004354.1-1239s1c1
Sequence:CCGGGTACATTTGTGGGTGGAGTTTCTCGAGAAACTCCACCCACAAATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004354
VALIDATED
NRARP MISSION shRNA Lentiviral Transduction Particles
NOTCH-regulated ankyrin repeat protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001004354.1-626s1c1
Sequence:CCGGCTATCTCATCACCAAGGCGAACTCGAGTTCGCCTTGGTGATGAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004354.1-437s1c1
Sequence:CCGGCAACTGCGAGTTCAACGTGAACTCGAGTTCACGTTGAACTCGCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001004354.1-979s1c1
Sequence:CCGGCAAGTTCGGAATCCCGAGATACTCGAGTATCTCGGGATTCCGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004354.1-1486s1c1
Sequence:CCGGCTCCCTCAAATCCGTGAGTTTCTCGAGAAACTCACGGATTTGAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004354.1-428s1c1
Sequence:CCGGGAACATGACCAACTGCGAGTTCTCGAGAACTCGCAGTTGGTCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004354.1-620s1c1
Sequence:CCGGCGTGCTCTATCTCATCACCAACTCGAGTTGGTGATGAGATAGAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004354.1-443s1c1
Sequence:CCGGCGAGTTCAACGTGAACTCGTTCTCGAGAACGAGTTCACGTTGAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001004354.1-1362s1c1
Sequence:CCGGCCATTTCTTGGTTGCACTGAACTCGAGTTCAGTGCAACCAAGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004354.1-1239s1c1
Sequence:CCGGGTACATTTGTGGGTGGAGTTTCTCGAGAAACTCCACCCACAAATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)