EMAIL THIS PAGE TO A FRIEND

NRBF2

nuclear receptor binding factor 2

122 Gene Product Result for
Synonyms: COPR1 COPR2 NRBF-2
UniProtKB ID: Q96F24, A6PW36, Q86UR2, Q96NP6, Q9H0S9, Q9H2I2
Gene ID:
Mouse(641340) nuclear receptor binding factor 2
Rat(58839) nuclear receptor binding factor 2
sheep(101122660) nuclear receptor binding factor 2
domestic guinea pig(100723940) nuclear receptor binding factor 2
naked mole-rat(101712097) nuclear receptor binding factor 2
Zebrafish(436886) nuclear receptor binding factor 2
dog(479220) nuclear receptor binding factor 2
cow(768316) nuclear receptor binding factor 2
domestic cat(101082779) nuclear receptor binding factor 2
chicken(423656) nuclear receptor binding factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001036293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001036293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001036293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030759 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030759 Rosetta Predictions human pricing
NM_022186 Rosetta Predictions rat pricing
NM_001036293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027931 predicted 330
2 SASI_Hs01_00027934 predicted 573
3 SASI_Hs01_00027928 predicted 588
4 SASI_Hs02_00358278 predicted 1111
5 SASI_Hs01_00027932 predicted 469
6 SASI_Hs02_00358279 predicted 960
7 SASI_Hs02_00358280 predicted 1046
8 SASI_Hs02_00358281 predicted 1127
9 SASI_Hs01_00027927 predicted 542
10 SASI_Hs01_00027929 predicted 237
11 SASI_Hs01_00027930 predicted 914
12 SASI_Hs01_00027933 predicted 601
13 SASI_Hs01_00027935 predicted 250
14 SASI_Hs01_00027936 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083682 predicted 1281
2 SASI_Rn01_00083683 predicted 1276
3 SASI_Rn01_00083684 predicted 1309
4 SASI_Rn01_00083685 predicted 1115
5 SASI_Rn01_00083686 predicted 1209
6 SASI_Rn01_00083687 predicted 467
7 SASI_Rn01_00083688 predicted 1282
8 SASI_Rn01_00083689 predicted 1133
9 SASI_Rn01_00083690 predicted 1257
10 SASI_Rn02_00262933 predicted 1208
11 SASI_Rn01_00083691 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001036293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044048 predicted 714
2 SASI_Mm01_00044049 predicted 237
3 SASI_Mm01_00044050 predicted 923
4 SASI_Mm01_00044051 predicted 1252
5 SASI_Mm01_00044052 predicted 1167
6 SASI_Mm01_00044056 predicted 1107
7 SASI_Mm01_00044054 predicted 309
8 SASI_Mm02_00289273 predicted 246
9 SASI_Mm01_00044057 predicted 236
10 SASI_Mm02_00289274 predicted 1157
11 SASI_Mm01_00044053 predicted 218
12 SASI_Mm01_00044055 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001036293
VALIDATED
NRBF2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor binding factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-1177s21c1
Sequence:CCGGCTTACCTTCGTCACGACTAAACTCGAGTTTAGTCGTGACGAAGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001036293.1-985s1c1
Sequence:CCGGCGGAGGACATTCTGAAAGGATCTCGAGATCCTTTCAGAATGTCCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001036293.2-604s21c1
Sequence:CCGGAGCCATCAGAGCCCTGTATTGCTCGAGCAATACAGGGCTCTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001036293.2-1177s1c1
Sequence:CCGGCTTACCTTCGTCACGACTAAACTCGAGTTTAGTCGTGACGAAGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-229s21c1
Sequence:CCGGGGAAATACGAAGAGGCGATTTCTCGAGAAATCGCCTCTTCGTATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-799s21c1
Sequence:CCGGTGGACGTCGATGCAGACTTTGCTCGAGCAAAGTCTGCATCGACGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001036293.2-1235s1c1
Sequence:CCGGCGGTTCGCTTTCTTATGATACCTCGAGGTATCATAAGAAAGCGAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-301s21c1
Sequence:CCGGAGTCTGAGCAGGCTCACTTATCTCGAGATAAGTGAGCCTGCTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001036293
VALIDATED
NRBF2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor binding factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-1177s21c1
Sequence:CCGGCTTACCTTCGTCACGACTAAACTCGAGTTTAGTCGTGACGAAGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001036293.1-985s1c1
Sequence:CCGGCGGAGGACATTCTGAAAGGATCTCGAGATCCTTTCAGAATGTCCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001036293.2-604s21c1
Sequence:CCGGAGCCATCAGAGCCCTGTATTGCTCGAGCAATACAGGGCTCTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001036293.2-1177s1c1
Sequence:CCGGCTTACCTTCGTCACGACTAAACTCGAGTTTAGTCGTGACGAAGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-229s21c1
Sequence:CCGGGGAAATACGAAGAGGCGATTTCTCGAGAAATCGCCTCTTCGTATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-799s21c1
Sequence:CCGGTGGACGTCGATGCAGACTTTGCTCGAGCAAAGTCTGCATCGACGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001036293.2-1235s1c1
Sequence:CCGGCGGTTCGCTTTCTTATGATACCTCGAGGTATCATAAGAAAGCGAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-301s21c1
Sequence:CCGGAGTCTGAGCAGGCTCACTTATCTCGAGATAAGTGAGCCTGCTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001036293
VALIDATED
NRBF2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor binding factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-1177s21c1
Sequence:CCGGCTTACCTTCGTCACGACTAAACTCGAGTTTAGTCGTGACGAAGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001036293.1-985s1c1
Sequence:CCGGCGGAGGACATTCTGAAAGGATCTCGAGATCCTTTCAGAATGTCCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001036293.2-604s21c1
Sequence:CCGGAGCCATCAGAGCCCTGTATTGCTCGAGCAATACAGGGCTCTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001036293.2-1177s1c1
Sequence:CCGGCTTACCTTCGTCACGACTAAACTCGAGTTTAGTCGTGACGAAGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-229s21c1
Sequence:CCGGGGAAATACGAAGAGGCGATTTCTCGAGAAATCGCCTCTTCGTATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-799s21c1
Sequence:CCGGTGGACGTCGATGCAGACTTTGCTCGAGCAAAGTCTGCATCGACGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001036293.2-1235s1c1
Sequence:CCGGCGGTTCGCTTTCTTATGATACCTCGAGGTATCATAAGAAAGCGAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001036293.2-301s21c1
Sequence:CCGGAGTCTGAGCAGGCTCACTTATCTCGAGATAAGTGAGCCTGCTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030759
NRBF2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor binding factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-269s21c1
Sequence:CCGGCAGACGAGCAGACCGTTTATTCTCGAGAATAAACGGTCTGCTCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-460s21c1
Sequence:CCGGAGCGTGAAGAAAGATTGAAAGCTCGAGCTTTCAATCTTTCTTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-398s21c1
Sequence:GTACCGGATTGCAAAGGGATAGCCATATCTCGAGATATGGCTATCCCTTTGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030759.3-1612s21c1
Sequence:CCGGCACACTTTGCACTACTCATAACTCGAGTTATGAGTAGTGCAAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-386s1c1
Sequence:CCGGCCTCATCCAAGAGAGATGGAACTCGAGTTCCATCTCTCTTGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-250s1c1
Sequence:CCGGCAGGCAAATACGAAGAGGCTACTCGAGTAGCCTCTTCGTATTTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-591s1c1
Sequence:CCGGCCAGACACACTACTTTATTTACTCGAGTAAATAAAGTAGTGTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-231s1c1
Sequence:CCGGGCAGACCGTTTATTAGCTGCACTCGAGTGCAGCTAATAAACGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-634s21c1
Sequence:CCGGATCCAGACACACTACTTTATTCTCGAGAATAAAGTAGTGTGTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-914s1c1
Sequence:CCGGGTTCGCAGCAAATACTGGGAACTCGAGTTCCCAGTATTTGCTGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030759
NRBF2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor binding factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-269s21c1
Sequence:CCGGCAGACGAGCAGACCGTTTATTCTCGAGAATAAACGGTCTGCTCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-460s21c1
Sequence:CCGGAGCGTGAAGAAAGATTGAAAGCTCGAGCTTTCAATCTTTCTTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-398s21c1
Sequence:GTACCGGATTGCAAAGGGATAGCCATATCTCGAGATATGGCTATCCCTTTGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030759.3-1612s21c1
Sequence:CCGGCACACTTTGCACTACTCATAACTCGAGTTATGAGTAGTGCAAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-386s1c1
Sequence:CCGGCCTCATCCAAGAGAGATGGAACTCGAGTTCCATCTCTCTTGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-250s1c1
Sequence:CCGGCAGGCAAATACGAAGAGGCTACTCGAGTAGCCTCTTCGTATTTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-591s1c1
Sequence:CCGGCCAGACACACTACTTTATTTACTCGAGTAAATAAAGTAGTGTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-231s1c1
Sequence:CCGGGCAGACCGTTTATTAGCTGCACTCGAGTGCAGCTAATAAACGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-634s21c1
Sequence:CCGGATCCAGACACACTACTTTATTCTCGAGAATAAAGTAGTGTGTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-914s1c1
Sequence:CCGGGTTCGCAGCAAATACTGGGAACTCGAGTTCCCAGTATTTGCTGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030759
NRBF2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor binding factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-269s21c1
Sequence:CCGGCAGACGAGCAGACCGTTTATTCTCGAGAATAAACGGTCTGCTCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-460s21c1
Sequence:CCGGAGCGTGAAGAAAGATTGAAAGCTCGAGCTTTCAATCTTTCTTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-398s21c1
Sequence:GTACCGGATTGCAAAGGGATAGCCATATCTCGAGATATGGCTATCCCTTTGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030759.3-1612s21c1
Sequence:CCGGCACACTTTGCACTACTCATAACTCGAGTTATGAGTAGTGCAAAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-386s1c1
Sequence:CCGGCCTCATCCAAGAGAGATGGAACTCGAGTTCCATCTCTCTTGGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-250s1c1
Sequence:CCGGCAGGCAAATACGAAGAGGCTACTCGAGTAGCCTCTTCGTATTTGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-591s1c1
Sequence:CCGGCCAGACACACTACTTTATTTACTCGAGTAAATAAAGTAGTGTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-231s1c1
Sequence:CCGGGCAGACCGTTTATTAGCTGCACTCGAGTGCAGCTAATAAACGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030759.3-634s21c1
Sequence:CCGGATCCAGACACACTACTTTATTCTCGAGAATAAAGTAGTGTGTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030759.1-914s1c1
Sequence:CCGGGTTCGCAGCAAATACTGGGAACTCGAGTTCCCAGTATTTGCTGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)