EMAIL THIS PAGE TO A FRIEND

NRCAM

neuronal cell adhesion molecule

253 Gene Product Result for
Gene ID:
Human(4897) Summary: Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(319504) neuron-glia-CAM-related cell adhesion molecule
Rat(497815) neuronal cell adhesion molecule
Zebrafish(556537) neuronal cell adhesion molecule
dog(475881) neuronal cell adhesion molecule
chicken(396202) neuronal cell adhesion molecule
cow(534500) neuronal cell adhesion molecule
Horse(100050997) neuronal cell adhesion molecule
domestic cat(101093257) neuronal cell adhesion molecule
naked mole-rat(101696564) neuronal cell adhesion molecule
domestic guinea pig(100720343) neuronal cell adhesion molecule
sheep(101106001) neuronal cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44832 Anti-NRCAM (AB1) antibody produced in rabbit affinity isolated antibody horse, guinea pig, mouse, rat, human, dog, bovine
western blot pricing
AV44833 Anti-NRCAM (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, human, rat
immunohistochemistry, western blot pricing
HPA012606 Anti-NRCAM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410847 Anti-NRCAM antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5201455 Monoclonal Anti-Nrcam - Alkaline Phosphatase antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201456 Monoclonal Anti-Nrcam - Apc antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201447 Monoclonal Anti-Nrcam - Atto 390 antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201448 Monoclonal Anti-Nrcam - Atto 488 antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201449 Monoclonal Anti-Nrcam - Atto 565 antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201450 Monoclonal Anti-Nrcam - Atto 594 antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201451 Monoclonal Anti-Nrcam - Atto 633 antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201452 Monoclonal Anti-Nrcam - Atto 655 antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201453 Monoclonal Anti-Nrcam - Atto 680 antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201454 Monoclonal Anti-Nrcam - Atto 700 antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201457 Monoclonal Anti-Nrcam - Biotin antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201458 Monoclonal Anti-Nrcam - Fitc antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201459 Monoclonal Anti-Nrcam - Hrp antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201460 Monoclonal Anti-Nrcam - Pe/Atto 594 antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201461 Monoclonal Anti-Nrcam - Percp antibody produced in mouse clone S364-51, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201462 Monoclonal Anti-Nrcam - Rpe antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201463 Monoclonal Anti-Nrcam - Streptavidin antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201446 Monoclonal Anti-Nrcam antibody produced in mouse clone S364-51, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0717 Human NRCAM / Neuronal Cell Adhesion Molecule ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052401 MISSION® esiRNA esiRNA human NRCAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037132 Rosetta Predictions human pricing
NM_001037133 Rosetta Predictions human pricing
NM_005010 Rosetta Predictions human pricing
NM_013150 Rosetta Predictions rat pricing
XM_579376 Rosetta Predictions rat pricing
NM_176930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308215 predicted 4489
2 SASI_Hs02_00308216 predicted 4708
3 SASI_Hs01_00037819 predicted 4399
4 SASI_Hs01_00037820 predicted 4537
5 SASI_Hs01_00037822 predicted 4875
6 SASI_Hs02_00308217 predicted 4806
7 SASI_Hs01_00037825 predicted 4526
8 SASI_Hs01_00037826 predicted 4439
9 SASI_Hs01_00037827 predicted 4862
10 SASI_Hs01_00037828 predicted 4829
11 SASI_Hs01_00037821 predicted 4564
12 SASI_Hs01_00037823 predicted 4827
13 SASI_Hs01_00037824 predicted 4472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308218 predicted 653
2 SASI_Hs02_00308219 predicted 876
3 SASI_Hs01_00237945 predicted 558
4 SASI_Hs01_00237946 predicted 690
5 SASI_Hs01_00237948 predicted 1033
6 SASI_Hs02_00308220 predicted 969
7 SASI_Hs01_00237951 predicted 692
8 SASI_Hs01_00237952 predicted 603
9 SASI_Hs01_00237953 predicted 1022
10 SASI_Hs01_00237954 predicted 984
11 SASI_Hs01_00237947 predicted 729
12 SASI_Hs01_00237949 predicted 989
13 SASI_Hs01_00237950 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338766 predicted 4125
2 SASI_Hs02_00338767 predicted 4344
3 SASI_Hs01_00081619 predicted 4036
4 SASI_Hs01_00081620 predicted 4170
5 SASI_Hs01_00081622 predicted 4505
6 SASI_Hs02_00338768 predicted 4449
7 SASI_Hs01_00081625 predicted 4160
8 SASI_Hs01_00081626 predicted 4073
9 SASI_Hs01_00081627 predicted 4498
10 SASI_Hs01_00081628 predicted 4457
11 SASI_Hs01_00081621 predicted 4202
12 SASI_Hs01_00081623 predicted 4458
13 SASI_Hs01_00081624 predicted 4102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055520 predicted 1648
2 SASI_Rn01_00055521 predicted 3095
3 SASI_Rn02_00260954 predicted 4020
4 SASI_Rn02_00260955 predicted 2174
5 SASI_Rn01_00055522 predicted 3541
6 SASI_Rn01_00055523 predicted 2118
7 SASI_Rn02_00260956 predicted 3142
8 SASI_Rn01_00055524 predicted 733
9 SASI_Rn02_00260957 predicted 3790
10 SASI_Rn01_00055525 predicted 646
11 SASI_Rn01_00055526 predicted 714
12 SASI_Rn01_00055527 predicted 2245
13 SASI_Rn01_00055528 predicted 1643
14 SASI_Rn01_00055529 predicted 4384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130098 predicted 1653
2 SASI_Rn01_00130099 predicted 3096
3 SASI_Rn01_00130100 predicted 2129
4 SASI_Rn01_00130101 predicted 738
5 SASI_Rn01_00130102 predicted 651
6 SASI_Rn01_00130103 predicted 714
7 SASI_Rn01_00130104 predicted 4476
8 SASI_Rn01_00130105 predicted 2244
9 SASI_Rn01_00130106 predicted 1642
10 SASI_Rn01_00130107 predicted 4384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071785 predicted 467
2 SASI_Mm01_00071786 predicted 1983
3 SASI_Mm01_00071787 predicted 3395
4 SASI_Mm01_00071788 predicted 1590
5 SASI_Mm01_00071789 predicted 3045
6 SASI_Mm01_00071790 predicted 1876
7 SASI_Mm01_00071791 predicted 4042
8 SASI_Mm02_00346822 predicted 1452
9 SASI_Mm01_00071792 predicted 3942
10 SASI_Mm01_00071793 predicted 933
11 SASI_Mm01_00071794 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005010
VALIDATED
NRCAM MISSION shRNA Bacterial Glycerol Stock
neuronal cell adhesion molecule
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000123083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005010.3-1350s1c1
Sequence:CCGGCCCAATTATTTACTGGGCAAACTCGAGTTTGCCCAGTAAATAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-1753s1c1
Sequence:CCGGGCCTCTAATGAATATGGATATCTCGAGATATCCATATTCATTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-1090s1c1
Sequence:CCGGCGCGAAGACTATATCTGTTATCTCGAGATAACAGATATAGTCTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-2108s1c1
Sequence:CCGGCCGAATATGCAGTTGTGCAAACTCGAGTTTGCACAACTGCATATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005010
VALIDATED
NRCAM MISSION shRNA shRNA Plasmid DNA
neuronal cell adhesion molecule
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000123083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005010.3-1350s1c1
Sequence:CCGGCCCAATTATTTACTGGGCAAACTCGAGTTTGCCCAGTAAATAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-1753s1c1
Sequence:CCGGGCCTCTAATGAATATGGATATCTCGAGATATCCATATTCATTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-1090s1c1
Sequence:CCGGCGCGAAGACTATATCTGTTATCTCGAGATAACAGATATAGTCTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-2108s1c1
Sequence:CCGGCCGAATATGCAGTTGTGCAAACTCGAGTTTGCACAACTGCATATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005010
VALIDATED
NRCAM MISSION shRNA Lentiviral Transduction Particles
neuronal cell adhesion molecule
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000123083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005010.3-1350s1c1
Sequence:CCGGCCCAATTATTTACTGGGCAAACTCGAGTTTGCCCAGTAAATAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-1753s1c1
Sequence:CCGGGCCTCTAATGAATATGGATATCTCGAGATATCCATATTCATTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-1090s1c1
Sequence:CCGGCGCGAAGACTATATCTGTTATCTCGAGATAACAGATATAGTCTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005010.3-2108s1c1
Sequence:CCGGCCGAATATGCAGTTGTGCAAACTCGAGTTTGCACAACTGCATATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176930
VALIDATED
NRCAM MISSION shRNA Bacterial Glycerol Stock
neuronal cell adhesion molecule
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-1085s1c1
Sequence:CCGGCCAGATTTAATCACACTCAAACTCGAGTTTGAGTGTGATTAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-3493s1c1
Sequence:CCGGCGGTACAAGTTCTATTTCTATCTCGAGATAGAAATAGAACTTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-2004s1c1
Sequence:CCGGCGCACGGAATAAACTAGGGATCTCGAGATCCCTAGTTTATTCCGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-1313s1c1
Sequence:CCGGGCCTACCTACTCCAATTATTTCTCGAGAAATAATTGGAGTAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1758s21c1
Sequence:CCGGATAGATGGCGATACCATTATACTCGAGTATAATGGTATCGCCATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1154s21c1
Sequence:CCGGGGACACCCGTGAGGACTATATCTCGAGATATAGTCCTCACGGGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176930.2-4278s1c1
Sequence:CCGGCCTCTCATACTACGGACATATCTCGAGATATGTCCGTAGTATGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1794s21c1
Sequence:CCGGGAAAGCTCAAGTGCGGTTTATCTCGAGATAAACCGCACTTGAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1039s21c1
Sequence:CCGGGATTACCTCCGGCCATAATATCTCGAGATATTATGGCCGGAGGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1101s21c1
Sequence:CCGGCGGGTTTCCCAAGGCCTAAATCTCGAGATTTAGGCCTTGGGAAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1410s21c1
Sequence:CCGGGGCCTACCTACTCCAATTATTCTCGAGAATAATTGGAGTAGGTAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176930
VALIDATED
NRCAM MISSION shRNA shRNA Plasmid DNA
neuronal cell adhesion molecule
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-1085s1c1
Sequence:CCGGCCAGATTTAATCACACTCAAACTCGAGTTTGAGTGTGATTAAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-3493s1c1
Sequence:CCGGCGGTACAAGTTCTATTTCTATCTCGAGATAGAAATAGAACTTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-2004s1c1
Sequence:CCGGCGCACGGAATAAACTAGGGATCTCGAGATCCCTAGTTTATTCCGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-1313s1c1
Sequence:CCGGGCCTACCTACTCCAATTATTTCTCGAGAAATAATTGGAGTAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1758s21c1
Sequence:CCGGATAGATGGCGATACCATTATACTCGAGTATAATGGTATCGCCATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1154s21c1
Sequence:CCGGGGACACCCGTGAGGACTATATCTCGAGATATAGTCCTCACGGGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176930.2-4278s1c1
Sequence:CCGGCCTCTCATACTACGGACATATCTCGAGATATGTCCGTAGTATGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1794s21c1
Sequence:CCGGGAAAGCTCAAGTGCGGTTTATCTCGAGATAAACCGCACTTGAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1039s21c1
Sequence:CCGGGATTACCTCCGGCCATAATATCTCGAGATATTATGGCCGGAGGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1101s21c1
Sequence:CCGGCGGGTTTCCCAAGGCCTAAATCTCGAGATTTAGGCCTTGGGAAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1410s21c1
Sequence:CCGGGGCCTACCTACTCCAATTATTCTCGAGAATAATTGGAGTAGGTAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176930
VALIDATED
NRCAM MISSION shRNA Lentiviral Transduction Particles
neuronal cell adhesion molecule
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-1085s1c1
Sequence:CCGGCCAGATTTAATCACACTCAAACTCGAGTTTGAGTGTGATTAAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-3493s1c1
Sequence:CCGGCGGTACAAGTTCTATTTCTATCTCGAGATAGAAATAGAACTTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-2004s1c1
Sequence:CCGGCGCACGGAATAAACTAGGGATCTCGAGATCCCTAGTTTATTCCGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176930.2-1313s1c1
Sequence:CCGGGCCTACCTACTCCAATTATTTCTCGAGAAATAATTGGAGTAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1758s21c1
Sequence:CCGGATAGATGGCGATACCATTATACTCGAGTATAATGGTATCGCCATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1154s21c1
Sequence:CCGGGGACACCCGTGAGGACTATATCTCGAGATATAGTCCTCACGGGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176930.2-4278s1c1
Sequence:CCGGCCTCTCATACTACGGACATATCTCGAGATATGTCCGTAGTATGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1794s21c1
Sequence:CCGGGAAAGCTCAAGTGCGGTTTATCTCGAGATAAACCGCACTTGAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1039s21c1
Sequence:CCGGGATTACCTCCGGCCATAATATCTCGAGATATTATGGCCGGAGGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1101s21c1
Sequence:CCGGCGGGTTTCCCAAGGCCTAAATCTCGAGATTTAGGCCTTGGGAAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176930.4-1410s21c1
Sequence:CCGGGGCCTACCTACTCCAATTATTCTCGAGAATAATTGGAGTAGGTAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)