EMAIL THIS PAGE TO A FRIEND

NRD1

nardilysin (N-arginine dibasic convertase)

70 Gene Product Result for
Synonyms: hNRD1 hNRD2
Gene ID:
Human(4898) Summary: This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(230598) nardilysin, N-arginine dibasic convertase, NRD convertase 1
Rat(25499) nardilysin 1
Zebrafish(557565) nardilysin (N-arginine dibasic convertase)
chicken(424635) nardilysin (N-arginine dibasic convertase)
domestic cat(101088678) nardilysin (N-arginine dibasic convertase)
cow(511254) nardilysin (N-arginine dibasic convertase)
Horse(100050978) nardilysin (N-arginine dibasic convertase)
dog(475354) nardilysin (N-arginine dibasic convertase)
sheep(101111671) nardilysin (N-arginine dibasic convertase)
domestic guinea pig(100722594) nardilysin (N-arginine dibasic convertase)
naked mole-rat(101716146) nardilysin (N-arginine dibasic convertase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101662 Rosetta Predictions human pricing
NM_002525 Rosetta Predictions human pricing
NM_012993 Rosetta Predictions rat pricing
NM_146150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322889 predicted 2375
2 SASI_Hs02_00322890 predicted 2438
3 SASI_Hs02_00322891 predicted 1170
4 SASI_Hs02_00322892 predicted 1988
5 SASI_Hs02_00322893 predicted 1880
6 SASI_Hs02_00322894 predicted 1156
7 SASI_Hs02_00322895 predicted 2243
8 SASI_Hs02_00322896 predicted 2243
9 SASI_Hs02_00322897 predicted 3221
10 SASI_Hs02_00322898 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038877 predicted 2584
2 SASI_Hs01_00038878 predicted 2644
3 SASI_Hs01_00038880 predicted 2194
4 SASI_Hs02_00333997 predicted 2085
5 SASI_Hs01_00038883 predicted 2448
6 SASI_Hs01_00038884 predicted 2439
7 SASI_Hs02_00333998 predicted 3018
8 SASI_Hs02_00333999 predicted 1631
9 SASI_Hs02_00334000 predicted 2709
10 SASI_Hs02_00334001 predicted 2906
11 SASI_Hs01_00038875 predicted 3596
12 SASI_Hs01_00038876 predicted 2221
13 SASI_Hs01_00038879 predicted 1187
14 SASI_Hs01_00038881 predicted 1131
15 SASI_Hs01_00038882 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036110 predicted 2623
2 SASI_Rn02_00260635 predicted 1836
3 SASI_Rn01_00036112 predicted 2155
4 SASI_Rn01_00036113 predicted 1215
5 SASI_Rn01_00036114 predicted 1151
6 SASI_Rn01_00036115 predicted 881
7 SASI_Rn02_00260636 predicted 1305
8 SASI_Rn01_00036116 predicted 2855
9 SASI_Rn01_00036117 predicted 2495
10 SASI_Rn01_00036118 predicted 2367
11 SASI_Rn01_00036111 predicted 3002
12 SASI_Rn01_00036119 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177704 predicted 2344
2 SASI_Mm01_00177705 predicted 2585
3 SASI_Mm01_00177706 predicted 2327
4 SASI_Mm01_00177707 predicted 2857
5 SASI_Mm01_00177708 predicted 922
6 SASI_Mm02_00341836 predicted 1129
7 SASI_Mm01_00177710 predicted 1185
8 SASI_Mm02_00341837 predicted 2643
9 SASI_Mm01_00177711 predicted 2522
10 SASI_Mm01_00177712 predicted 3366
11 SASI_Mm01_00177709 predicted 845
12 SASI_Mm01_00177713 predicted 1526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002525
VALIDATED
NRD1 MISSION shRNA Bacterial Glycerol Stock
nardilysin (N-arginine dibasic convertase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2990s21c1
Sequence:CCGGGAATATGCCCGTTGGTCTATGCTCGAGCATAGACCAACGGGCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2552s21c1
Sequence:CCGGGAAACAGAATACCCAGTTAAACTCGAGTTTAACTGGGTATTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-1766s21c1
Sequence:CCGGGGCCATTTAACGGATCCATTTCTCGAGAAATGGATCCGTTAAATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002525.1-522s1c1
Sequence:CCGGCCTAAGTAATATGGAAGGTAACTCGAGTTACCTTCCATATTACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-2463s1c1
Sequence:CCGGCCATCTAATTTCACCGTTGATCTCGAGATCAACGGTGAAATTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-2650s1c1
Sequence:CCGGCCTCTACTGTTTCAGCTCATTCTCGAGAATGAGCTGAAACAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-3122s1c1
Sequence:CCGGCCAGGAGTCTAAGAGAATATACTCGAGTATATTCTCTTAGACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-1452s1c1
Sequence:CCGGGCGTTACTACTCTTCTCATTACTCGAGTAATGAGAAGAGTAGTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2449s21c1
Sequence:CCGGTGAACTGTGGAATAGTAATTTCTCGAGAAATTACTATTCCACAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2759s21c1
Sequence:CCGGGTGGCACAGCTGGAGTATAAACTCGAGTTTATACTCCAGCTGTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002525
VALIDATED
NRD1 MISSION shRNA shRNA Plasmid DNA
nardilysin (N-arginine dibasic convertase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2990s21c1
Sequence:CCGGGAATATGCCCGTTGGTCTATGCTCGAGCATAGACCAACGGGCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2552s21c1
Sequence:CCGGGAAACAGAATACCCAGTTAAACTCGAGTTTAACTGGGTATTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-1766s21c1
Sequence:CCGGGGCCATTTAACGGATCCATTTCTCGAGAAATGGATCCGTTAAATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002525.1-522s1c1
Sequence:CCGGCCTAAGTAATATGGAAGGTAACTCGAGTTACCTTCCATATTACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-2463s1c1
Sequence:CCGGCCATCTAATTTCACCGTTGATCTCGAGATCAACGGTGAAATTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-2650s1c1
Sequence:CCGGCCTCTACTGTTTCAGCTCATTCTCGAGAATGAGCTGAAACAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-3122s1c1
Sequence:CCGGCCAGGAGTCTAAGAGAATATACTCGAGTATATTCTCTTAGACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-1452s1c1
Sequence:CCGGGCGTTACTACTCTTCTCATTACTCGAGTAATGAGAAGAGTAGTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2449s21c1
Sequence:CCGGTGAACTGTGGAATAGTAATTTCTCGAGAAATTACTATTCCACAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2759s21c1
Sequence:CCGGGTGGCACAGCTGGAGTATAAACTCGAGTTTATACTCCAGCTGTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002525
VALIDATED
NRD1 MISSION shRNA Lentiviral Transduction Particles
nardilysin (N-arginine dibasic convertase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2990s21c1
Sequence:CCGGGAATATGCCCGTTGGTCTATGCTCGAGCATAGACCAACGGGCATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2552s21c1
Sequence:CCGGGAAACAGAATACCCAGTTAAACTCGAGTTTAACTGGGTATTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-1766s21c1
Sequence:CCGGGGCCATTTAACGGATCCATTTCTCGAGAAATGGATCCGTTAAATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002525.1-522s1c1
Sequence:CCGGCCTAAGTAATATGGAAGGTAACTCGAGTTACCTTCCATATTACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-2463s1c1
Sequence:CCGGCCATCTAATTTCACCGTTGATCTCGAGATCAACGGTGAAATTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-2650s1c1
Sequence:CCGGCCTCTACTGTTTCAGCTCATTCTCGAGAATGAGCTGAAACAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-3122s1c1
Sequence:CCGGCCAGGAGTCTAAGAGAATATACTCGAGTATATTCTCTTAGACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002525.1-1452s1c1
Sequence:CCGGGCGTTACTACTCTTCTCATTACTCGAGTAATGAGAAGAGTAGTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2449s21c1
Sequence:CCGGTGAACTGTGGAATAGTAATTTCTCGAGAAATTACTATTCCACAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002525.2-2759s21c1
Sequence:CCGGGTGGCACAGCTGGAGTATAAACTCGAGTTTATACTCCAGCTGTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146150
VALIDATED
NRD1 MISSION shRNA Bacterial Glycerol Stock
nardilysin (N-arginine dibasic convertase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-3008s21c3
Sequence:CCGGGCAACCAAATACAACTCCGAACTCGAGTTCGGAGTTGTATTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-2424s21c2
Sequence:CCGGCCGCTGTCTTTACCATGATAACTCGAGTTATCATGGTAAAGACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146150.2-3698s21c2
Sequence:CCGGCCAAACACTTACGTCAGCAATCTCGAGATTGCTGACGTAAGTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-2424s1c1
Sequence:CCGGCCGCTGTCTTTACCATGATAACTCGAGTTATCATGGTAAAGACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-3698s1c1
Sequence:CCGGCCAAACACTTACGTCAGCAATCTCGAGATTGCTGACGTAAGTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-3008s1c1
Sequence:CCGGGCAACCAAATACAACTCCGAACTCGAGTTCGGAGTTGTATTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-1187s1c1
Sequence:CCGGGCTCATTACATGACCTTAGTTCTCGAGAACTAAGGTCATGTAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-530s1c1
Sequence:CCGGGCTGAGATACAAGATGATGATCTCGAGATCATCATCTTGTATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-1187s21c3
Sequence:CCGGGCTCATTACATGACCTTAGTTCTCGAGAACTAAGGTCATGTAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-530s21c3
Sequence:CCGGGCTGAGATACAAGATGATGATCTCGAGATCATCATCTTGTATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146150
VALIDATED
NRD1 MISSION shRNA shRNA Plasmid DNA
nardilysin (N-arginine dibasic convertase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-3008s21c3
Sequence:CCGGGCAACCAAATACAACTCCGAACTCGAGTTCGGAGTTGTATTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-2424s21c2
Sequence:CCGGCCGCTGTCTTTACCATGATAACTCGAGTTATCATGGTAAAGACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146150.2-3698s21c2
Sequence:CCGGCCAAACACTTACGTCAGCAATCTCGAGATTGCTGACGTAAGTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-2424s1c1
Sequence:CCGGCCGCTGTCTTTACCATGATAACTCGAGTTATCATGGTAAAGACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-3698s1c1
Sequence:CCGGCCAAACACTTACGTCAGCAATCTCGAGATTGCTGACGTAAGTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-3008s1c1
Sequence:CCGGGCAACCAAATACAACTCCGAACTCGAGTTCGGAGTTGTATTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-1187s1c1
Sequence:CCGGGCTCATTACATGACCTTAGTTCTCGAGAACTAAGGTCATGTAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-530s1c1
Sequence:CCGGGCTGAGATACAAGATGATGATCTCGAGATCATCATCTTGTATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-1187s21c3
Sequence:CCGGGCTCATTACATGACCTTAGTTCTCGAGAACTAAGGTCATGTAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-530s21c3
Sequence:CCGGGCTGAGATACAAGATGATGATCTCGAGATCATCATCTTGTATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146150
VALIDATED
NRD1 MISSION shRNA Lentiviral Transduction Particles
nardilysin (N-arginine dibasic convertase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-3008s21c3
Sequence:CCGGGCAACCAAATACAACTCCGAACTCGAGTTCGGAGTTGTATTTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-2424s21c2
Sequence:CCGGCCGCTGTCTTTACCATGATAACTCGAGTTATCATGGTAAAGACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146150.2-3698s21c2
Sequence:CCGGCCAAACACTTACGTCAGCAATCTCGAGATTGCTGACGTAAGTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-2424s1c1
Sequence:CCGGCCGCTGTCTTTACCATGATAACTCGAGTTATCATGGTAAAGACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-3698s1c1
Sequence:CCGGCCAAACACTTACGTCAGCAATCTCGAGATTGCTGACGTAAGTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-3008s1c1
Sequence:CCGGGCAACCAAATACAACTCCGAACTCGAGTTCGGAGTTGTATTTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-1187s1c1
Sequence:CCGGGCTCATTACATGACCTTAGTTCTCGAGAACTAAGGTCATGTAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146150.2-530s1c1
Sequence:CCGGGCTGAGATACAAGATGATGATCTCGAGATCATCATCTTGTATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-1187s21c3
Sequence:CCGGGCTCATTACATGACCTTAGTTCTCGAGAACTAAGGTCATGTAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146150.2-530s21c3
Sequence:CCGGGCTGAGATACAAGATGATGATCTCGAGATCATCATCTTGTATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)