EMAIL THIS PAGE TO A FRIEND

NRDE2

NRDE-2, necessary for RNA interference, domain containing

93 Gene Product Result for
Synonyms: C14orf102
UniProtKB ID: Q9H7Z3, B4DH71, Q4G0A7, Q9NWH6
Gene ID:
Mouse(217827) nrde-2 necessary for RNA interference, domain containing
Rat(314381) NRDE-2, necessary for RNA interference, domain containing
dog(490830) NRDE-2, necessary for RNA interference, domain containing
domestic cat(101094426) NRDE-2, necessary for RNA interference, domain containing
cow(100138828) NRDE-2, necessary for RNA interference, domain containing
naked mole-rat(101714673) NRDE-2, necessary for RNA interference, domain containing
domestic guinea pig(100734265) NRDE-2, necessary for RNA interference, domain containing
sheep(101114962) NRDE-2, necessary for RNA interference, domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017970 Rosetta Predictions human pricing
NM_199043 Rosetta Predictions human pricing
XM_001064833 Rosetta Predictions rat pricing
XM_234465 Rosetta Predictions rat pricing
XM_484171 Rosetta Predictions mouse pricing
XM_901387 Rosetta Predictions mouse pricing
XM_912077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060644 predicted 2158
2 SASI_Hs01_00060645 predicted 2255
3 SASI_Hs02_00351003 predicted 2234
4 SASI_Hs01_00060646 predicted 803
5 SASI_Hs01_00060647 predicted 3206
6 SASI_Hs01_00060649 predicted 3031
7 SASI_Hs02_00351004 predicted 866
8 SASI_Hs01_00060650 predicted 1361
9 SASI_Hs02_00351005 predicted 2803
10 SASI_Hs02_00351006 predicted 3516
11 SASI_Hs01_00060648 predicted 3173
12 SASI_Hs01_00060651 predicted 2735
13 SASI_Hs01_00060652 predicted 1549
14 SASI_Hs01_00060653 predicted 3317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099331 predicted 1810
2 SASI_Hs01_00099332 predicted 1911
3 SASI_Hs02_00372527 predicted 1888
4 SASI_Hs01_00099333 predicted 464
5 SASI_Hs01_00099334 predicted 2864
6 SASI_Hs01_00099337 predicted 2695
7 SASI_Hs02_00372528 predicted 519
8 SASI_Hs01_00099338 predicted 1024
9 SASI_Hs01_00099340 predicted 1204
10 SASI_Hs02_00372529 predicted 2451
11 SASI_Hs01_00099335 predicted 2837
12 SASI_Hs01_00099336 predicted 1753
13 SASI_Hs01_00099339 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311913 predicted 2003
2 SASI_Rn02_00311914 predicted 1327
3 SASI_Rn02_00311915 predicted 2267
4 SASI_Rn02_00311916 predicted 2041
5 SASI_Rn02_00311917 predicted 688
6 SASI_Rn02_00311918 predicted 1317
7 SASI_Rn02_00311919 predicted 2067
8 SASI_Rn02_00311920 predicted 600
9 SASI_Rn02_00311921 predicted 1419
10 SASI_Rn02_00311922 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388499 predicted 1423
2 SASI_Rn02_00388500 predicted 2254
3 SASI_Rn02_00388501 predicted 1580
4 SASI_Rn02_00388502 predicted 2521
5 SASI_Rn02_00388503 predicted 2297
6 SASI_Rn02_00388504 predicted 1564
7 SASI_Rn02_00388505 predicted 2321
8 SASI_Rn02_00388506 predicted 1664
9 SASI_Rn02_00388507 predicted 3267
10 SASI_Rn02_00388508 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242679 predicted 3198
2 SASI_Mm01_00242680 predicted 1591
3 SASI_Mm01_00242681 predicted 3117
4 SASI_Mm01_00242682 predicted 2828
5 SASI_Mm01_00242683 predicted 3138
6 SASI_Mm01_00242684 predicted 3320
7 SASI_Mm01_00242685 predicted 1920
8 SASI_Mm01_00242686 predicted 3096
9 SASI_Mm01_00242687 predicted 3043
10 SASI_Mm01_00242688 predicted 2914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218001 predicted 1227
2 SASI_Mm01_00218002 predicted 931
3 SASI_Mm01_00218003 predicted 1168
4 SASI_Mm01_00218004 predicted 1066
5 SASI_Mm01_00218005 predicted 1253
6 SASI_Mm01_00218006 predicted 1068
7 SASI_Mm01_00218007 predicted 1428
8 SASI_Mm01_00218008 predicted 1330
9 SASI_Mm01_00218009 predicted 1435
10 SASI_Mm01_00218010 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436810 predicted 3120
2 SASI_Mm02_00436811 predicted 1572
3 SASI_Mm02_00436812 predicted 1014
4 SASI_Mm02_00436813 predicted 2115
5 SASI_Mm02_00436814 predicted 1463
6 SASI_Mm02_00436815 predicted 3138
7 SASI_Mm02_00436816 predicted 1072
8 SASI_Mm02_00436817 predicted 3324
9 SASI_Mm02_00436818 predicted 1924
10 SASI_Mm02_00436819 predicted 2161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017970
VALIDATED
NRDE2 MISSION shRNA Bacterial Glycerol Stock
NRDE-2, necessary for RNA interference, domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-2735s1c1
Sequence:CCGGCGCCTAATTAGCCTGGCTAAACTCGAGTTTAGCCAGGCTAATTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-3322s1c1
Sequence:CCGGCTTTCTGGTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAACCAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-2944s1c1
Sequence:CCGGCCACATGAAAGTGAGTGTTTACTCGAGTAAACACTCACTTTCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017970.2-2736s1c1
Sequence:CCGGGCCTAATTAGCCTGGCTAAATCTCGAGATTTAGCCAGGCTAATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-1536s21c1
Sequence:CCGGTCAAACCCGACAGCGTGAAAGCTCGAGCTTTCACGCTGTCGGGTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-624s21c1
Sequence:CCGGACCCTAAGAAGCAGTGCATATCTCGAGATATGCACTGCTTCTTAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017970.2-3633s21c1
Sequence:CCGGATGTTCTTTCTCGATAGTAATCTCGAGATTACTATCGAGAAAGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-2758s21c1
Sequence:CCGGCTTCATGCTCTTCCAGTATTTCTCGAGAAATACTGGAAGAGCATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-2625s21c1
Sequence:CCGGAGGTGTTGGCTGTTCACATTTCTCGAGAAATGTGAACAGCCAACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-3216s21c1
Sequence:CCGGCAATTCCTGAGACCGGCTTAACTCGAGTTAAGCCGGTCTCAGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-682s21c1
Sequence:CCGGCAAGCAGGTTGAACGCTATTTCTCGAGAAATAGCGTTCAACCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017970
VALIDATED
NRDE2 MISSION shRNA shRNA Plasmid DNA
NRDE-2, necessary for RNA interference, domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-2735s1c1
Sequence:CCGGCGCCTAATTAGCCTGGCTAAACTCGAGTTTAGCCAGGCTAATTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-3322s1c1
Sequence:CCGGCTTTCTGGTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAACCAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-2944s1c1
Sequence:CCGGCCACATGAAAGTGAGTGTTTACTCGAGTAAACACTCACTTTCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017970.2-2736s1c1
Sequence:CCGGGCCTAATTAGCCTGGCTAAATCTCGAGATTTAGCCAGGCTAATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-1536s21c1
Sequence:CCGGTCAAACCCGACAGCGTGAAAGCTCGAGCTTTCACGCTGTCGGGTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-624s21c1
Sequence:CCGGACCCTAAGAAGCAGTGCATATCTCGAGATATGCACTGCTTCTTAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017970.2-3633s21c1
Sequence:CCGGATGTTCTTTCTCGATAGTAATCTCGAGATTACTATCGAGAAAGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-2758s21c1
Sequence:CCGGCTTCATGCTCTTCCAGTATTTCTCGAGAAATACTGGAAGAGCATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-2625s21c1
Sequence:CCGGAGGTGTTGGCTGTTCACATTTCTCGAGAAATGTGAACAGCCAACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-3216s21c1
Sequence:CCGGCAATTCCTGAGACCGGCTTAACTCGAGTTAAGCCGGTCTCAGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-682s21c1
Sequence:CCGGCAAGCAGGTTGAACGCTATTTCTCGAGAAATAGCGTTCAACCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017970
VALIDATED
NRDE2 MISSION shRNA Lentiviral Transduction Particles
NRDE-2, necessary for RNA interference, domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-2735s1c1
Sequence:CCGGCGCCTAATTAGCCTGGCTAAACTCGAGTTTAGCCAGGCTAATTAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-3322s1c1
Sequence:CCGGCTTTCTGGTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAACCAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017970.2-2944s1c1
Sequence:CCGGCCACATGAAAGTGAGTGTTTACTCGAGTAAACACTCACTTTCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017970.2-2736s1c1
Sequence:CCGGGCCTAATTAGCCTGGCTAAATCTCGAGATTTAGCCAGGCTAATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-1536s21c1
Sequence:CCGGTCAAACCCGACAGCGTGAAAGCTCGAGCTTTCACGCTGTCGGGTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-624s21c1
Sequence:CCGGACCCTAAGAAGCAGTGCATATCTCGAGATATGCACTGCTTCTTAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017970.2-3633s21c1
Sequence:CCGGATGTTCTTTCTCGATAGTAATCTCGAGATTACTATCGAGAAAGAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-2758s21c1
Sequence:CCGGCTTCATGCTCTTCCAGTATTTCTCGAGAAATACTGGAAGAGCATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-2625s21c1
Sequence:CCGGAGGTGTTGGCTGTTCACATTTCTCGAGAAATGTGAACAGCCAACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-3216s21c1
Sequence:CCGGCAATTCCTGAGACCGGCTTAACTCGAGTTAAGCCGGTCTCAGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017970.2-682s21c1
Sequence:CCGGCAAGCAGGTTGAACGCTATTTCTCGAGAAATAGCGTTCAACCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183155
VALIDATED
NRDE2 MISSION shRNA Bacterial Glycerol Stock
NRDE-2, necessary for RNA interference, domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183155.2-2279s21c1
Sequence:CCGGCGAGATTGCAAAGGTCATTTGCTCGAGCAAATGACCTTTGCAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-570s21c1
Sequence:CCGGCCTGCCAACTGGGAGTATAAACTCGAGTTTATACTCCCAGTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-1581s21c1
Sequence:CCGGGTGAAAGAGCTGCCTACTAAACTCGAGTTTAGTAGGCAGCTCTTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183155.2-2590s21c1
Sequence:CCGGGCCGAGCGGTCCACATATTAACTCGAGTTAATATGTGGACCGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-3148s21c1
Sequence:CCGGATTTGGAGCCTTGGCTATTTGCTCGAGCAAATAGCCAAGGCTCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183155
VALIDATED
NRDE2 MISSION shRNA shRNA Plasmid DNA
NRDE-2, necessary for RNA interference, domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183155.2-2279s21c1
Sequence:CCGGCGAGATTGCAAAGGTCATTTGCTCGAGCAAATGACCTTTGCAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-570s21c1
Sequence:CCGGCCTGCCAACTGGGAGTATAAACTCGAGTTTATACTCCCAGTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-1581s21c1
Sequence:CCGGGTGAAAGAGCTGCCTACTAAACTCGAGTTTAGTAGGCAGCTCTTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183155.2-2590s21c1
Sequence:CCGGGCCGAGCGGTCCACATATTAACTCGAGTTAATATGTGGACCGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-3148s21c1
Sequence:CCGGATTTGGAGCCTTGGCTATTTGCTCGAGCAAATAGCCAAGGCTCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183155
VALIDATED
NRDE2 MISSION shRNA Lentiviral Transduction Particles
NRDE-2, necessary for RNA interference, domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183155.2-2279s21c1
Sequence:CCGGCGAGATTGCAAAGGTCATTTGCTCGAGCAAATGACCTTTGCAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-570s21c1
Sequence:CCGGCCTGCCAACTGGGAGTATAAACTCGAGTTTATACTCCCAGTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-1581s21c1
Sequence:CCGGGTGAAAGAGCTGCCTACTAAACTCGAGTTTAGTAGGCAGCTCTTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183155.2-2590s21c1
Sequence:CCGGGCCGAGCGGTCCACATATTAACTCGAGTTAATATGTGGACCGCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183155.2-3148s21c1
Sequence:CCGGATTTGGAGCCTTGGCTATTTGCTCGAGCAAATAGCCAAGGCTCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)