EMAIL THIS PAGE TO A FRIEND

NRF1

nuclear respiratory factor 1

171 Gene Product Result for
Synonyms: ALPHA-PAL
UniProtKB ID: Q16656, Q15305
Gene ID:
Human(4899) Summary: This gene encodes a protein that homodimerizes and functions as a transcription factor which activates the expression of some key metabolic genes regulating cellular growth and nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. The protein has also been associated with the regulation of neurite outgrowth. Alternate transcriptional splice variants, which encode the same protein, have been characterized. Additional variants encoding different protein isoforms have been described but they have not been fully characterized. Confusion has occurred in bibliographic databases due to the shared symbol of NRF1 for this gene and for 'nuclear factor (erythroid-derived 2)-like 1' which has an official symbol of NFE2L1. [provided by RefSeq, Jul 2008]
Mouse(18181) nuclear respiratory factor 1
Rat(312195) nuclear respiratory factor 1
Zebrafish(64604) nuclear respiratory factor 1
domestic cat(101085873) nuclear respiratory factor 1
cow(509232) nuclear respiratory factor 1
Horse(100056975) nuclear respiratory factor 1
dog(482260) nuclear respiratory factor 1
chicken(416677) nuclear respiratory factor 1
sheep(443490) nuclear respiratory factor 1
naked mole-rat(101703414) nuclear respiratory factor 1
domestic guinea pig(100720898) nuclear respiratory factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040110 Rosetta Predictions human pricing
NM_005011 Rosetta Predictions human pricing
NM_001100708 Rosetta Predictions rat pricing
NM_010938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235236 predicted 978
2 SASI_Hs01_00235237 predicted 418
3 SASI_Hs02_00308835 predicted 380
4 SASI_Hs01_00235240 predicted 1419
5 SASI_Hs01_00235241 predicted 1296
6 SASI_Hs01_00235242 predicted 1442
7 SASI_Hs01_00235244 predicted 482
8 SASI_Hs01_00235245 predicted 575
9 SASI_Hs02_00308836 predicted 818
10 SASI_Hs02_00308837 predicted 1131
11 SASI_Hs01_00235238 predicted 385
12 SASI_Hs01_00235239 predicted 680
13 SASI_Hs01_00235243 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014735 predicted 991
2 SASI_Hs01_00014736 predicted 429
3 SASI_Hs02_00338769 predicted 402
4 SASI_Hs01_00014739 predicted 1431
5 SASI_Hs01_00014740 predicted 1316
6 SASI_Hs01_00014741 predicted 1450
7 SASI_Hs01_00014743 predicted 498
8 SASI_Hs01_00014744 predicted 591
9 SASI_Hs02_00338770 predicted 831
10 SASI_Hs02_00338771 predicted 1151
11 SASI_Hs01_00014737 predicted 400
12 SASI_Hs01_00014738 predicted 689
13 SASI_Hs01_00014742 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210348 predicted 529
2 SASI_Rn02_00210349 predicted 1279
3 SASI_Rn02_00210350 predicted 674
4 SASI_Rn02_00210351 predicted 1564
5 SASI_Rn02_00210352 predicted 1103
6 SASI_Rn02_00210353 predicted 1332
7 SASI_Rn02_00210354 predicted 518
8 SASI_Rn02_00210355 predicted 1593
9 SASI_Rn02_00210356 predicted 327
10 SASI_Rn02_00210357 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166926 predicted 615
2 SASI_Mm01_00166927 predicted 1327
3 SASI_Mm01_00166928 predicted 568
4 SASI_Mm01_00166929 predicted 726
5 SASI_Mm01_00166930 predicted 1607
6 SASI_Mm01_00166931 predicted 993
7 SASI_Mm01_00166932 predicted 1548
8 SASI_Mm01_00166933 predicted 1732
9 SASI_Mm01_00166934 predicted 576
10 SASI_Mm01_00166935 predicted 1628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005011
NRF1 MISSION shRNA Bacterial Glycerol Stock
nuclear respiratory factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-546s1c1
Sequence:CCGGGCGTAAGTACAAGAGCATGATCTCGAGATCATGCTCTTGTACTTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005011.3-272s21c1
Sequence:CCGGCTTACGATGACTCAGATATACCTCGAGGTATATCTGAGTCATCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-358s1c1
Sequence:CCGGCCTCATGTATTTGAGTCTAATCTCGAGATTAGACTCAAATACATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-1414s1c1
Sequence:CCGGCAAGATGCTAATGGCCTCTTTCTCGAGAAAGAGGCCATTAGCATCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-428s1c1
Sequence:CCGGCCACGTTAGATGAATATACTACTCGAGTAGTATATTCATCTAACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005011.3-423s21c1
Sequence:CCGGTATCCGGAAGAGGCAACAAACCTCGAGGTTTGTTGCCTCTTCCGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-1103s1c1
Sequence:CCGGCCGTTGCCCAAGTGAATTATTCTCGAGAATAATTCACTTGGGCAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005011
NRF1 MISSION shRNA shRNA Plasmid DNA
nuclear respiratory factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-546s1c1
Sequence:CCGGGCGTAAGTACAAGAGCATGATCTCGAGATCATGCTCTTGTACTTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005011.3-272s21c1
Sequence:CCGGCTTACGATGACTCAGATATACCTCGAGGTATATCTGAGTCATCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-358s1c1
Sequence:CCGGCCTCATGTATTTGAGTCTAATCTCGAGATTAGACTCAAATACATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-1414s1c1
Sequence:CCGGCAAGATGCTAATGGCCTCTTTCTCGAGAAAGAGGCCATTAGCATCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-428s1c1
Sequence:CCGGCCACGTTAGATGAATATACTACTCGAGTAGTATATTCATCTAACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005011.3-423s21c1
Sequence:CCGGTATCCGGAAGAGGCAACAAACCTCGAGGTTTGTTGCCTCTTCCGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-1103s1c1
Sequence:CCGGCCGTTGCCCAAGTGAATTATTCTCGAGAATAATTCACTTGGGCAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005011
NRF1 MISSION shRNA Lentiviral Transduction Particles
nuclear respiratory factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-546s1c1
Sequence:CCGGGCGTAAGTACAAGAGCATGATCTCGAGATCATGCTCTTGTACTTACGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005011.3-272s21c1
Sequence:CCGGCTTACGATGACTCAGATATACCTCGAGGTATATCTGAGTCATCGTAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-358s1c1
Sequence:CCGGCCTCATGTATTTGAGTCTAATCTCGAGATTAGACTCAAATACATGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-1414s1c1
Sequence:CCGGCAAGATGCTAATGGCCTCTTTCTCGAGAAAGAGGCCATTAGCATCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-428s1c1
Sequence:CCGGCCACGTTAGATGAATATACTACTCGAGTAGTATATTCATCTAACGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005011.3-423s21c1
Sequence:CCGGTATCCGGAAGAGGCAACAAACCTCGAGGTTTGTTGCCTCTTCCGGATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005011.2-1103s1c1
Sequence:CCGGCCGTTGCCCAAGTGAATTATTCTCGAGAATAATTCACTTGGGCAACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010938
VALIDATED
NRF1 MISSION shRNA Bacterial Glycerol Stock
nuclear respiratory factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010938.2-434s1c1
Sequence:CCGGCCCGAGGACACTTCTTATGATCTCGAGATCATAAGAAGTGTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010938.2-676s1c1
Sequence:CCGGGCAAGCGATTGTACTCTGCATCTCGAGATGCAGAGTACAATCGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010938.2-2039s1c1
Sequence:CCGGCCAGACTTCTTTGTGCAGAAACTCGAGTTTCTGCACAAAGAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010938.2-572s1c1
Sequence:CCGGCCTCATGTGTTTGAGTCTAATCTCGAGATTAGACTCAAACACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010938.2-680s1c1
Sequence:CCGGGCGATTGTACTCTGCATCTCACTCGAGTGAGATGCAGAGTACAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-818s21c1
Sequence:CCGGCTGCGCCACAGGAGGTTAATTCTCGAGAATTAACCTCCTGTGGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-917s21c1
Sequence:CCGGTCCCAGAGATGCTCAAGTATTCTCGAGAATACTTGAGCATCTCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-1374s21c1
Sequence:CCGGCACGTTACAGGGCGGTGAAATCTCGAGATTTCACCGCCCTGTAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010938.3-3162s21c1
Sequence:CCGGTCCCGTGCGTGATAGTGTATTCTCGAGAATACACTATCACGCACGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010938
VALIDATED
NRF1 MISSION shRNA shRNA Plasmid DNA
nuclear respiratory factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010938.2-434s1c1
Sequence:CCGGCCCGAGGACACTTCTTATGATCTCGAGATCATAAGAAGTGTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010938.2-676s1c1
Sequence:CCGGGCAAGCGATTGTACTCTGCATCTCGAGATGCAGAGTACAATCGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010938.2-2039s1c1
Sequence:CCGGCCAGACTTCTTTGTGCAGAAACTCGAGTTTCTGCACAAAGAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010938.2-572s1c1
Sequence:CCGGCCTCATGTGTTTGAGTCTAATCTCGAGATTAGACTCAAACACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010938.2-680s1c1
Sequence:CCGGGCGATTGTACTCTGCATCTCACTCGAGTGAGATGCAGAGTACAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-818s21c1
Sequence:CCGGCTGCGCCACAGGAGGTTAATTCTCGAGAATTAACCTCCTGTGGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-917s21c1
Sequence:CCGGTCCCAGAGATGCTCAAGTATTCTCGAGAATACTTGAGCATCTCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-1374s21c1
Sequence:CCGGCACGTTACAGGGCGGTGAAATCTCGAGATTTCACCGCCCTGTAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010938.3-3162s21c1
Sequence:CCGGTCCCGTGCGTGATAGTGTATTCTCGAGAATACACTATCACGCACGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010938
VALIDATED
NRF1 MISSION shRNA Lentiviral Transduction Particles
nuclear respiratory factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010938.2-434s1c1
Sequence:CCGGCCCGAGGACACTTCTTATGATCTCGAGATCATAAGAAGTGTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010938.2-676s1c1
Sequence:CCGGGCAAGCGATTGTACTCTGCATCTCGAGATGCAGAGTACAATCGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010938.2-2039s1c1
Sequence:CCGGCCAGACTTCTTTGTGCAGAAACTCGAGTTTCTGCACAAAGAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010938.2-572s1c1
Sequence:CCGGCCTCATGTGTTTGAGTCTAATCTCGAGATTAGACTCAAACACATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010938.2-680s1c1
Sequence:CCGGGCGATTGTACTCTGCATCTCACTCGAGTGAGATGCAGAGTACAATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-818s21c1
Sequence:CCGGCTGCGCCACAGGAGGTTAATTCTCGAGAATTAACCTCCTGTGGCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-917s21c1
Sequence:CCGGTCCCAGAGATGCTCAAGTATTCTCGAGAATACTTGAGCATCTCTGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010938.3-1374s21c1
Sequence:CCGGCACGTTACAGGGCGGTGAAATCTCGAGATTTCACCGCCCTGTAACGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010938.3-3162s21c1
Sequence:CCGGTCCCGTGCGTGATAGTGTATTCTCGAGAATACACTATCACGCACGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)