EMAIL THIS PAGE TO A FRIEND

NRG1

neuregulin 1

371 Gene Product Result for
Synonyms: ARIA GGF GGF2 HGL HRG HRG1 HRGA MST131 NDF SMDF
Gene ID:
Human(3084) Summary: The protein encoded by this gene was originally identified as a 44-kD glycoprotein that interacts with the NEU/ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. This protein is a signaling protein that mediates cell-cell interactions and plays critical roles in the growth and development of multiple organ systems. It is known that an extraordinary variety of different isoforms are produced from this gene through alternative promoter usage and splicing. These isoforms are tissue-specifically expressed and differ significantly in their structure, and thereby these isoforms are classified into types I, II, III, IV, V and VI. The gene dysregulation has been linked to diseases such as cancer, schizophrenia and bipolar disorder (BPD). [provided by RefSeq, May 2009]
Mouse(211323) neuregulin 1
Rat(112400) neuregulin 1
Zebrafish(796461) neuregulin 1
chicken(373906) neuregulin 1
dog(482861) neuregulin 1
Horse(100061417) neuregulin 1
cow(281361) neuregulin 1
sheep(678677) neuregulin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095101 MISSION® esiRNA esiRNA human NRG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004495 Rosetta Predictions human pricing
NM_013956 Rosetta Predictions human pricing
NM_013957 Rosetta Predictions human pricing
NM_013958 Rosetta Predictions human pricing
NM_013959 Rosetta Predictions human pricing
NM_013960 Rosetta Predictions human pricing
NM_013961 Rosetta Predictions human pricing
NM_013962 Rosetta Predictions human pricing
NM_013964 Rosetta Predictions human pricing
NM_031588 Rosetta Predictions rat pricing
NM_178591 Rosetta Predictions mouse pricing
XM_893383 Rosetta Predictions mouse pricing
XM_900803 Rosetta Predictions mouse pricing
XM_900806 Rosetta Predictions mouse pricing
XM_900807 Rosetta Predictions mouse pricing
XM_900811 Rosetta Predictions mouse pricing
XM_900817 Rosetta Predictions mouse pricing
XM_900821 Rosetta Predictions mouse pricing
XM_900824 Rosetta Predictions mouse pricing
XM_900832 Rosetta Predictions mouse pricing
XM_900835 Rosetta Predictions mouse pricing
XM_990248 Rosetta Predictions mouse pricing
XM_990278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337742 predicted 501
2 SASI_Hs01_00083485 predicted 1108
3 SASI_Hs01_00083486 predicted 656
4 SASI_Hs01_00083487 predicted 940
5 SASI_Hs01_00083488 predicted 831
6 SASI_Hs01_00083489 predicted 796
7 SASI_Hs02_00337743 predicted 1180
8 SASI_Hs01_00083491 predicted 1128
9 SASI_Hs01_00083492 predicted 925
10 SASI_Hs02_00337744 predicted 1103
11 SASI_Hs01_00083490 predicted 1142
12 SASI_Hs01_00083493 predicted 820
13 SASI_Hs01_00083494 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344904 predicted 498
2 SASI_Hs01_00048061 predicted 2114
3 SASI_Hs01_00048062 predicted 826
4 SASI_Hs01_00048063 predicted 2123
5 SASI_Hs02_00344905 predicted 2131
6 SASI_Hs01_00048064 predicted 1156
7 SASI_Hs01_00048065 predicted 1611
8 SASI_Hs01_00048067 predicted 1176
9 SASI_Hs01_00048068 predicted 926
10 SASI_Hs02_00344906 predicted 802
11 SASI_Hs01_00048060 predicted 262
12 SASI_Hs01_00048066 predicted 1027
13 SASI_Hs01_00048069 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344907 predicted 503
2 SASI_Hs01_00180327 predicted 654
3 SASI_Hs01_00180328 predicted 2089
4 SASI_Hs01_00180329 predicted 829
5 SASI_Hs01_00180330 predicted 2101
6 SASI_Hs01_00180331 predicted 2104
7 SASI_Hs01_00180332 predicted 1161
8 SASI_Hs02_00344908 predicted 1593
9 SASI_Hs01_00180333 predicted 923
10 SASI_Hs01_00180335 predicted 801
11 SASI_Hs01_00180334 predicted 839
12 SASI_Hs01_00180336 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344909 predicted 505
2 SASI_Hs01_00137925 predicted 1164
3 SASI_Hs01_00137926 predicted 655
4 SASI_Hs01_00137927 predicted 946
5 SASI_Hs01_00137928 predicted 828
6 SASI_Hs01_00137929 predicted 801
7 SASI_Hs01_00137930 predicted 920
8 SASI_Hs02_00344910 predicted 803
9 SASI_Hs02_00344911 predicted 924
10 SASI_Hs01_00137932 predicted 642
11 SASI_Hs01_00137924 predicted 772
12 SASI_Hs01_00137931 predicted 863
13 SASI_Hs01_00137933 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217616 predicted 1575
2 SASI_Hs02_00344912 predicted 1846
3 SASI_Hs01_00217617 predicted 1800
4 SASI_Hs01_00217618 predicted 1770
5 SASI_Hs01_00217619 predicted 1762
6 SASI_Hs01_00217620 predicted 1746
7 SASI_Hs01_00217621 predicted 1741
8 SASI_Hs01_00217622 predicted 1791
9 SASI_Hs01_00217623 predicted 1751
10 SASI_Hs01_00217624 predicted 1670
11 SASI_Hs01_00217625 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344913 predicted 499
2 SASI_Hs01_00146892 predicted 659
3 SASI_Hs01_00146893 predicted 824
4 SASI_Hs01_00146894 predicted 1815
5 SASI_Hs01_00146895 predicted 1835
6 SASI_Hs02_00344914 predicted 1598
7 SASI_Hs01_00146897 predicted 1819
8 SASI_Hs01_00146898 predicted 926
9 SASI_Hs01_00146899 predicted 1882
10 SASI_Hs01_00146901 predicted 804
11 SASI_Hs01_00146896 predicted 1030
12 SASI_Hs01_00146900 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344915 predicted 501
2 SASI_Hs01_00186867 predicted 1161
3 SASI_Hs01_00186868 predicted 658
4 SASI_Hs01_00186869 predicted 945
5 SASI_Hs01_00186870 predicted 822
6 SASI_Hs01_00186871 predicted 799
7 SASI_Hs01_00186872 predicted 920
8 SASI_Hs01_00186874 predicted 802
9 SASI_Hs01_00186875 predicted 922
10 SASI_Hs01_00186876 predicted 641
11 SASI_Hs01_00186873 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071533 predicted 1479
2 SASI_Hs02_00344916 predicted 1748
3 SASI_Hs01_00071534 predicted 1707
4 SASI_Hs01_00071535 predicted 1672
5 SASI_Hs01_00071536 predicted 1657
6 SASI_Hs01_00071537 predicted 1652
7 SASI_Hs01_00071538 predicted 1651
8 SASI_Hs01_00071539 predicted 1690
9 SASI_Hs01_00071540 predicted 1648
10 SASI_Hs01_00071541 predicted 1573
11 SASI_Hs01_00071542 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344917 predicted 500
2 SASI_Hs01_00025497 predicted 652
3 SASI_Hs01_00025498 predicted 2097
4 SASI_Hs01_00025499 predicted 830
5 SASI_Hs01_00025500 predicted 2110
6 SASI_Hs01_00025501 predicted 2110
7 SASI_Hs02_00344918 predicted 1604
8 SASI_Hs01_00025502 predicted 1414
9 SASI_Hs01_00025503 predicted 920
10 SASI_Hs01_00025505 predicted 798
11 SASI_Hs01_00025504 predicted 507
12 SASI_Hs01_00025506 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046024 predicted 878
2 SASI_Rn01_00046025 predicted 664
3 SASI_Rn01_00046026 predicted 1928
4 SASI_Rn01_00046028 predicted 1947
5 SASI_Rn01_00046029 predicted 723
6 SASI_Rn01_00046030 predicted 1257
7 SASI_Rn01_00046031 predicted 2006
8 SASI_Rn01_00046032 predicted 2081
9 SASI_Rn02_00264858 predicted 1995
10 SASI_Rn01_00046033 predicted 709
11 SASI_Rn01_00046027 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348905 predicted 1872
2 SASI_Mm02_00348906 predicted 1239
3 SASI_Mm02_00348907 predicted 1774
4 SASI_Mm02_00348908 predicted 1766
5 SASI_Mm02_00348909 predicted 1797
6 SASI_Mm02_00348910 predicted 837
7 SASI_Mm02_00348911 predicted 1804
8 SASI_Mm02_00348912 predicted 1428
9 SASI_Mm02_00348913 predicted 1084
10 SASI_Mm02_00348914 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239508 predicted 2056
2 SASI_Mm01_00239509 predicted 1424
3 SASI_Mm01_00239510 predicted 1957
4 SASI_Mm01_00239511 predicted 1092
5 SASI_Mm01_00239512 predicted 1951
6 SASI_Mm01_00239513 predicted 1983
7 SASI_Mm01_00239514 predicted 1992
8 SASI_Mm01_00239515 predicted 1614
9 SASI_Mm01_00239516 predicted 1285
10 SASI_Mm01_00239517 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215367 predicted 2096
2 SASI_Mm01_00215368 predicted 1462
3 SASI_Mm01_00215369 predicted 1994
4 SASI_Mm01_00215370 predicted 1122
5 SASI_Mm01_00215371 predicted 1977
6 SASI_Mm01_00215372 predicted 2015
7 SASI_Mm01_00215373 predicted 2023
8 SASI_Mm01_00215374 predicted 1656
9 SASI_Mm01_00215375 predicted 1322
10 SASI_Mm01_00215376 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250456 predicted 1105
2 SASI_Mm01_00250457 predicted 1228
3 SASI_Mm01_00250458 predicted 1095
4 SASI_Mm01_00250459 predicted 1316
5 SASI_Mm01_00250460 predicted 1297
6 SASI_Mm01_00250461 predicted 1274
7 SASI_Mm01_00250462 predicted 1273
8 SASI_Mm01_00250463 predicted 1293
9 SASI_Mm01_00250464 predicted 1287
10 SASI_Mm01_00250465 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265842 predicted 537
2 SASI_Mm01_00265843 predicted 464
3 SASI_Mm01_00265844 predicted 422
4 SASI_Mm01_00265845 predicted 397
5 SASI_Mm01_00265846 predicted 580
6 SASI_Mm01_00265847 predicted 442
7 SASI_Mm01_00265848 predicted 538
8 SASI_Mm01_00265849 predicted 469
9 SASI_Mm01_00265850 predicted 620
10 SASI_Mm01_00265851 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228132 predicted 637
2 SASI_Mm01_00228133 predicted 740
3 SASI_Mm01_00228134 predicted 640
4 SASI_Mm01_00228135 predicted 607
5 SASI_Mm01_00228136 predicted 592
6 SASI_Mm01_00228137 predicted 599
7 SASI_Mm01_00228138 predicted 607
8 SASI_Mm01_00228139 predicted 731
9 SASI_Mm01_00228140 predicted 603
10 SASI_Mm01_00228141 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275156 predicted 656
2 SASI_Mm01_00275157 predicted 797
3 SASI_Mm01_00275158 predicted 600
4 SASI_Mm01_00275159 predicted 598
5 SASI_Mm01_00275160 predicted 738
6 SASI_Mm01_00275161 predicted 662
7 SASI_Mm01_00275162 predicted 612
8 SASI_Mm01_00275163 predicted 694
9 SASI_Mm01_00275164 predicted 759
10 SASI_Mm01_00275165 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244665 predicted 485
2 SASI_Mm01_00244666 predicted 570
3 SASI_Mm01_00244667 predicted 327
4 SASI_Mm01_00244668 predicted 451
5 SASI_Mm01_00244669 predicted 506
6 SASI_Mm01_00244670 predicted 577
7 SASI_Mm01_00244671 predicted 540
8 SASI_Mm01_00244672 predicted 285
9 SASI_Mm01_00244673 predicted 346
10 SASI_Mm01_00244674 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209689 predicted 249
2 SASI_Mm01_00209690 predicted 134
3 SASI_Mm01_00209691 predicted 151
4 SASI_Mm01_00209692 predicted 371
5 SASI_Mm01_00209693 predicted 715
6 SASI_Mm01_00209694 predicted 512
7 SASI_Mm01_00209695 predicted 379
8 SASI_Mm01_00209696 predicted 331
9 SASI_Mm01_00209697 predicted 339
10 SASI_Mm01_00209698 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247208 predicted 580
2 SASI_Mm01_00247209 predicted 439
3 SASI_Mm01_00247210 predicted 786
4 SASI_Mm01_00247211 predicted 677
5 SASI_Mm01_00247212 predicted 793
6 SASI_Mm01_00247213 predicted 545
7 SASI_Mm01_00247214 predicted 684
8 SASI_Mm01_00247215 predicted 639
9 SASI_Mm01_00247216 predicted 403
10 SASI_Mm01_00247217 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231786 predicted 1129
2 SASI_Mm01_00231787 predicted 949
3 SASI_Mm01_00231788 predicted 814
4 SASI_Mm01_00231789 predicted 1203
5 SASI_Mm01_00231790 predicted 756
6 SASI_Mm01_00231791 predicted 1196
7 SASI_Mm01_00231792 predicted 1069
8 SASI_Mm01_00231793 predicted 573
9 SASI_Mm01_00231794 predicted 1170
10 SASI_Mm01_00231795 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214545 predicted 2074
2 SASI_Mm01_00214546 predicted 1448
3 SASI_Mm01_00214547 predicted 1982
4 SASI_Mm01_00214548 predicted 1970
5 SASI_Mm01_00214549 predicted 2000
6 SASI_Mm01_00214550 predicted 2011
7 SASI_Mm01_00214551 predicted 1642
8 SASI_Mm01_00214552 predicted 1302
9 SASI_Mm01_00214553 predicted 1287
10 SASI_Mm01_00214554 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262768 predicted 2071
2 SASI_Mm01_00262769 predicted 1440
3 SASI_Mm01_00262770 predicted 1964
4 SASI_Mm01_00262771 predicted 1957
5 SASI_Mm01_00262772 predicted 1993
6 SASI_Mm01_00262773 predicted 1999
7 SASI_Mm01_00262774 predicted 1632
8 SASI_Mm01_00262775 predicted 1299
9 SASI_Mm01_00262776 predicted 1277
10 SASI_Mm01_00262777 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004495
VALIDATED
NRG1 MISSION shRNA Bacterial Glycerol Stock
neuregulin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004495.3-878s21c1
Sequence:CCGGGACAGTGCCTCTGCCAATATCCTCGAGGATATTGGCAGAGGCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004495.3-829s21c1
Sequence:CCGGGGCTGATTCTGGAGAGTATATCTCGAGATATACTCTCCAGAATCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004495.3-1458s21c1
Sequence:CCGGGATATCACAGAGGCCTATAACCTCGAGGTTATAGGCCTCTGTGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-834s1c1
Sequence:CCGGCGTGGAATCAAACGAGATCATCTCGAGATGATCTCGTTTGATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-923s1c1
Sequence:CCGGCCACAGAAGGAGCAAATACTTCTCGAGAAGTATTTGCTCCTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-613s1c1
Sequence:CCGGCGGTGTGAAACCAGTTCTGAACTCGAGTTCAGAACTGGTTTCACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004495.3-1159s21c1
Sequence:CCGGGAAATCCTGTGTGTCGCTTATCTCGAGATAAGCGACACACAGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004495
VALIDATED
NRG1 MISSION shRNA shRNA Plasmid DNA
neuregulin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004495.3-878s21c1
Sequence:CCGGGACAGTGCCTCTGCCAATATCCTCGAGGATATTGGCAGAGGCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004495.3-829s21c1
Sequence:CCGGGGCTGATTCTGGAGAGTATATCTCGAGATATACTCTCCAGAATCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004495.3-1458s21c1
Sequence:CCGGGATATCACAGAGGCCTATAACCTCGAGGTTATAGGCCTCTGTGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-834s1c1
Sequence:CCGGCGTGGAATCAAACGAGATCATCTCGAGATGATCTCGTTTGATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-923s1c1
Sequence:CCGGCCACAGAAGGAGCAAATACTTCTCGAGAAGTATTTGCTCCTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-613s1c1
Sequence:CCGGCGGTGTGAAACCAGTTCTGAACTCGAGTTCAGAACTGGTTTCACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004495.3-1159s21c1
Sequence:CCGGGAAATCCTGTGTGTCGCTTATCTCGAGATAAGCGACACACAGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004495
VALIDATED
NRG1 MISSION shRNA Lentiviral Transduction Particles
neuregulin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004495.3-878s21c1
Sequence:CCGGGACAGTGCCTCTGCCAATATCCTCGAGGATATTGGCAGAGGCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004495.3-829s21c1
Sequence:CCGGGGCTGATTCTGGAGAGTATATCTCGAGATATACTCTCCAGAATCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004495.3-1458s21c1
Sequence:CCGGGATATCACAGAGGCCTATAACCTCGAGGTTATAGGCCTCTGTGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-834s1c1
Sequence:CCGGCGTGGAATCAAACGAGATCATCTCGAGATGATCTCGTTTGATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-923s1c1
Sequence:CCGGCCACAGAAGGAGCAAATACTTCTCGAGAAGTATTTGCTCCTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004495.1-613s1c1
Sequence:CCGGCGGTGTGAAACCAGTTCTGAACTCGAGTTCAGAACTGGTTTCACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004495.3-1159s21c1
Sequence:CCGGGAAATCCTGTGTGTCGCTTATCTCGAGATAAGCGACACACAGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486093
VALIDATED
NRG1 MISSION shRNA Bacterial Glycerol Stock
neuregulin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486093.1-550s1c1
Sequence:CCGGCCCAGATTGAAAGAGATGAAACTCGAGTTTCATCTCTTTCAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-862s1c1
Sequence:CCGGGCCTCAACTGAAAGACCCTATCTCGAGATAGGGTCTTTCAGTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-1717s1c1
Sequence:CCGGGCCAGCTTCTACAAGCATCTTCTCGAGAAGATGCTTGTAGAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-2833s1c1
Sequence:CCGGCCTATTAAGAAAGTCACCAATCTCGAGATTGGTGACTTTCTTAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-1497s1c1
Sequence:CCGGGCCACAAACAACAGAAACTAACTCGAGTTAGTTTCTGTTGTTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486093
VALIDATED
NRG1 MISSION shRNA shRNA Plasmid DNA
neuregulin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486093.1-550s1c1
Sequence:CCGGCCCAGATTGAAAGAGATGAAACTCGAGTTTCATCTCTTTCAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-862s1c1
Sequence:CCGGGCCTCAACTGAAAGACCCTATCTCGAGATAGGGTCTTTCAGTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-1717s1c1
Sequence:CCGGGCCAGCTTCTACAAGCATCTTCTCGAGAAGATGCTTGTAGAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-2833s1c1
Sequence:CCGGCCTATTAAGAAAGTCACCAATCTCGAGATTGGTGACTTTCTTAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-1497s1c1
Sequence:CCGGGCCACAAACAACAGAAACTAACTCGAGTTAGTTTCTGTTGTTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486093
VALIDATED
NRG1 MISSION shRNA Lentiviral Transduction Particles
neuregulin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486093.1-550s1c1
Sequence:CCGGCCCAGATTGAAAGAGATGAAACTCGAGTTTCATCTCTTTCAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-862s1c1
Sequence:CCGGGCCTCAACTGAAAGACCCTATCTCGAGATAGGGTCTTTCAGTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-1717s1c1
Sequence:CCGGGCCAGCTTCTACAAGCATCTTCTCGAGAAGATGCTTGTAGAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-2833s1c1
Sequence:CCGGCCTATTAAGAAAGTCACCAATCTCGAGATTGGTGACTTTCTTAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486093.1-1497s1c1
Sequence:CCGGGCCACAAACAACAGAAACTAACTCGAGTTAGTTTCTGTTGTTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)