EMAIL THIS PAGE TO A FRIEND

NRG4

neuregulin 4

54 Gene Product Result for
Synonyms: HRG4
UniProtKB ID: Q8WWG1, A6NIE8
Gene ID:
Human(145957) Summary: The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]
Mouse(83961) neuregulin 4
Rat(690919) neuregulin 4
chicken(415354) neuregulin 4
cow(616763) surfeit locus protein 1-like
cow(100848238) neuregulin 4
sheep(101115657) neuregulin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138573 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138573 Rosetta Predictions human pricing
XM_001076144 Rosetta Predictions rat pricing
NM_032002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235406 predicted 262
2 SASI_Hs01_00235407 predicted 383
3 SASI_Hs01_00235408 predicted 388
4 SASI_Hs01_00235409 predicted 206
5 SASI_Hs01_00235410 predicted 375
6 SASI_Hs01_00235411 predicted 338
7 SASI_Hs01_00235412 predicted 385
8 SASI_Hs01_00235413 predicted 310
9 SASI_Hs01_00235414 predicted 256
10 SASI_Hs01_00235415 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352191 predicted 313
2 SASI_Rn02_00352192 predicted 288
3 SASI_Rn02_00352193 predicted 272
4 SASI_Rn02_00352194 predicted 307
5 SASI_Rn02_00352195 predicted 276
6 SASI_Rn02_00352196 predicted 282
7 SASI_Rn02_00352197 predicted 257
8 SASI_Rn02_00352198 predicted 230
9 SASI_Rn02_00352199 predicted 234
10 SASI_Rn02_00352200 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114713 predicted 586
2 SASI_Mm02_00337207 predicted 662
3 SASI_Mm02_00337208 predicted 834
4 SASI_Mm02_00337209 predicted 954
5 SASI_Mm02_00337210 predicted 818
6 SASI_Mm02_00337211 predicted 899
7 SASI_Mm02_00337212 predicted 859
8 SASI_Mm02_00337213 predicted 694
9 SASI_Mm02_00337214 predicted 749
10 SASI_Mm02_00337215 predicted 807
11 SASI_Mm01_00114714 predicted 228
12 SASI_Mm01_00114715 predicted 325
13 SASI_Mm01_00114716 predicted 345
14 SASI_Mm01_00114717 predicted 359
15 SASI_Mm01_00114718 predicted 428
16 SASI_Mm01_00114719 predicted 325
17 SASI_Mm01_00114720 predicted 333
18 SASI_Mm01_00114721 predicted 366
19 SASI_Mm01_00114722 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138573
NRG4 MISSION shRNA Bacterial Glycerol Stock
neuregulin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-480s21c1
Sequence:CCGGACCTGGTAGAGACGAGCAGTACTCGAGTACTGCTCGTCTCTACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-311s1c1
Sequence:CCGGGAGCTCGTTGTGAAGAGGTTTCTCGAGAAACCTCTTCACAACGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138573.1-540s1c1
Sequence:CCGGCGTCAAAGTGAACCAAATCATCTCGAGATGATTTGGTTCACTTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-392s1c1
Sequence:CCGGCGGTCCTAGTAACACTTATCACTCGAGTGATAAGTGTTACTAGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-394s1c1
Sequence:CCGGGTCCTAGTAACACTTATCATTCTCGAGAATGATAAGTGTTACTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-457s1c1
Sequence:CCGGGCCAGTTCAGTCCAGTATGATCTCGAGATCATACTGGACTGAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-251s21c1
Sequence:CCGGTGTTATGTGATACCTACTATTCTCGAGAATAGTAGGTATCACATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-338s21c1
Sequence:CCGGGGCTCCAGCATCCAAACTAAACTCGAGTTTAGTTTGGATGCTGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138573
NRG4 MISSION shRNA shRNA Plasmid DNA
neuregulin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-480s21c1
Sequence:CCGGACCTGGTAGAGACGAGCAGTACTCGAGTACTGCTCGTCTCTACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-311s1c1
Sequence:CCGGGAGCTCGTTGTGAAGAGGTTTCTCGAGAAACCTCTTCACAACGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138573.1-540s1c1
Sequence:CCGGCGTCAAAGTGAACCAAATCATCTCGAGATGATTTGGTTCACTTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-392s1c1
Sequence:CCGGCGGTCCTAGTAACACTTATCACTCGAGTGATAAGTGTTACTAGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-394s1c1
Sequence:CCGGGTCCTAGTAACACTTATCATTCTCGAGAATGATAAGTGTTACTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-457s1c1
Sequence:CCGGGCCAGTTCAGTCCAGTATGATCTCGAGATCATACTGGACTGAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-251s21c1
Sequence:CCGGTGTTATGTGATACCTACTATTCTCGAGAATAGTAGGTATCACATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-338s21c1
Sequence:CCGGGGCTCCAGCATCCAAACTAAACTCGAGTTTAGTTTGGATGCTGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138573
NRG4 MISSION shRNA Lentiviral Transduction Particles
neuregulin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-480s21c1
Sequence:CCGGACCTGGTAGAGACGAGCAGTACTCGAGTACTGCTCGTCTCTACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-311s1c1
Sequence:CCGGGAGCTCGTTGTGAAGAGGTTTCTCGAGAAACCTCTTCACAACGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138573.1-540s1c1
Sequence:CCGGCGTCAAAGTGAACCAAATCATCTCGAGATGATTTGGTTCACTTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-392s1c1
Sequence:CCGGCGGTCCTAGTAACACTTATCACTCGAGTGATAAGTGTTACTAGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-394s1c1
Sequence:CCGGGTCCTAGTAACACTTATCATTCTCGAGAATGATAAGTGTTACTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138573.1-457s1c1
Sequence:CCGGGCCAGTTCAGTCCAGTATGATCTCGAGATCATACTGGACTGAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-251s21c1
Sequence:CCGGTGTTATGTGATACCTACTATTCTCGAGAATAGTAGGTATCACATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138573.2-338s21c1
Sequence:CCGGGGCTCCAGCATCCAAACTAAACTCGAGTTTAGTTTGGATGCTGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032002
NRG4 MISSION shRNA Bacterial Glycerol Stock
neuregulin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-222s1c1
Sequence:CCGGCAGCATCCCAAGCGAAAGTAACTCGAGTTACTTTCGCTTGGGATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-156s1c1
Sequence:CCGGCCCATTCTGTAGGTGCATTGACTCGAGTCAATGCACCTACAGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-359s1c1
Sequence:CCGGGCCTGGTAGAGACAAACAATACTCGAGTATTGTTTGTCTCTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-297s1c1
Sequence:CCGGGCTCTGCTTCCTGTGCAGGAACTCGAGTTCCTGCACAGGAAGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032002.1-544s1c1
Sequence:CCGGCTCTACTGTTTGATTGTTCATCTCGAGATGAACAATCAAACAGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032002
NRG4 MISSION shRNA shRNA Plasmid DNA
neuregulin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-222s1c1
Sequence:CCGGCAGCATCCCAAGCGAAAGTAACTCGAGTTACTTTCGCTTGGGATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-156s1c1
Sequence:CCGGCCCATTCTGTAGGTGCATTGACTCGAGTCAATGCACCTACAGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-359s1c1
Sequence:CCGGGCCTGGTAGAGACAAACAATACTCGAGTATTGTTTGTCTCTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-297s1c1
Sequence:CCGGGCTCTGCTTCCTGTGCAGGAACTCGAGTTCCTGCACAGGAAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032002.1-544s1c1
Sequence:CCGGCTCTACTGTTTGATTGTTCATCTCGAGATGAACAATCAAACAGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032002
NRG4 MISSION shRNA Lentiviral Transduction Particles
neuregulin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-222s1c1
Sequence:CCGGCAGCATCCCAAGCGAAAGTAACTCGAGTTACTTTCGCTTGGGATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-156s1c1
Sequence:CCGGCCCATTCTGTAGGTGCATTGACTCGAGTCAATGCACCTACAGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-359s1c1
Sequence:CCGGGCCTGGTAGAGACAAACAATACTCGAGTATTGTTTGTCTCTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032002.1-297s1c1
Sequence:CCGGGCTCTGCTTCCTGTGCAGGAACTCGAGTTCCTGCACAGGAAGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032002.1-544s1c1
Sequence:CCGGCTCTACTGTTTGATTGTTCATCTCGAGATGAACAATCAAACAGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)