EMAIL THIS PAGE TO A FRIEND

NRIP1

nuclear receptor interacting protein 1

257 Gene Product Result for
Synonyms: RIP140
UniProtKB ID: P48552, Q8IWE8
Gene ID:
Human(8204) Summary: Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
Mouse(268903) nuclear receptor interacting protein 1
Rat(304157) nuclear receptor interacting protein 1
chicken(427966) nuclear receptor interacting protein 1
dog(478385) nuclear receptor interacting protein 1
cow(524960) nuclear receptor interacting protein 1
Horse(100054242) nuclear receptor interacting protein 1
domestic cat(101091722) nuclear receptor interacting protein 1
sheep(101117463) nuclear receptor interacting protein 1
naked mole-rat(101713774) nuclear receptor interacting protein 1
Domestic Rabbit(100348085) nuclear receptor interacting protein 1
domestic guinea pig(100712824) nuclear receptor interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003489 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003489 Rosetta Predictions human pricing
XM_001067591 Rosetta Predictions rat pricing
XM_221724 Rosetta Predictions rat pricing
NM_173440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016476 predicted 3456
2 SASI_Hs01_00016477 predicted 809
3 SASI_Hs01_00016478 predicted 1483
4 SASI_Hs01_00016481 predicted 1222
5 SASI_Hs01_00016482 predicted 2202
6 SASI_Hs01_00016483 predicted 1453
7 SASI_Hs01_00016484 predicted 3587
8 SASI_Hs01_00016485 predicted 852
9 SASI_Hs02_00335767 predicted 2187
10 SASI_Hs02_00335768 predicted 3670
11 SASI_Hs01_00016479 predicted 1418
12 SASI_Hs01_00016480 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321504 predicted 1906
2 SASI_Rn02_00321505 predicted 2001
3 SASI_Rn02_00321506 predicted 2712
4 SASI_Rn02_00321507 predicted 704
5 SASI_Rn02_00321508 predicted 2248
6 SASI_Rn02_00321509 predicted 2496
7 SASI_Rn02_00321510 predicted 3141
8 SASI_Rn02_00321511 predicted 1985
9 SASI_Rn02_00321512 predicted 877
10 SASI_Rn02_00321513 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380317 predicted 1903
2 SASI_Rn02_00380318 predicted 1999
3 SASI_Rn02_00380319 predicted 2713
4 SASI_Rn02_00380320 predicted 709
5 SASI_Rn02_00380321 predicted 2247
6 SASI_Rn02_00380322 predicted 2490
7 SASI_Rn02_00380323 predicted 3138
8 SASI_Rn02_00380324 predicted 1983
9 SASI_Rn02_00380325 predicted 874
10 SASI_Rn02_00380326 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116387 predicted 1590
2 SASI_Mm01_00116388 predicted 4085
3 SASI_Mm01_00116389 predicted 3866
4 SASI_Mm01_00116390 predicted 3426
5 SASI_Mm01_00116391 predicted 1420
6 SASI_Mm01_00116392 predicted 2045
7 SASI_Mm01_00116393 predicted 1830
8 SASI_Mm01_00116394 predicted 1806
9 SASI_Mm01_00116395 predicted 2296
10 SASI_Mm01_00116396 predicted 1956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173440
VALIDATED
NRIP1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor interacting protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-4221s1c1
Sequence:CCGGGCCATACCACTTTGGGTCTTTCTCGAGAAAGACCCAAAGTGGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-1024s1c1
Sequence:CCGGGCTGTCTGATTCCATCGTGAACTCGAGTTCACGATGGAATCAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173440.1-1850s1c1
Sequence:CCGGGCTGCTAATAACAGTCTGCTTCTCGAGAAGCAGACTGTTATTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-3356s1c1
Sequence:CCGGGCCGTAGATACTGCCAATCATCTCGAGATGATTGGCAGTATCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-2716s1c1
Sequence:CCGGCGGTCTGATTGATAGATTAAACTCGAGTTTAATCTATCAATCAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-2230s21c1
Sequence:CCGGCAGTTGCTGCTCGGCCATAAACTCGAGTTTATGGCCGAGCAGCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-1979s21c1
Sequence:CCGGCCGATAACAACCCGAGCTTTACTCGAGTAAAGCTCGGGTTGTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-751s21c1
Sequence:CCGGGATGTGCATCAGGATTCTATTCTCGAGAATAGAATCCTGATGCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-3855s21c1
Sequence:CCGGTAAGTGGGTCATCGCAGATATCTCGAGATATCTGCGATGACCCACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-3434s21c1
Sequence:CCGGGCAGGAATGAGCTCGATTATACTCGAGTATAATCGAGCTCATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-780s21c1
Sequence:CCGGTTACCTCGAAGGGTTACTAATCTCGAGATTAGTAACCCTTCGAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173440
VALIDATED
NRIP1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor interacting protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-4221s1c1
Sequence:CCGGGCCATACCACTTTGGGTCTTTCTCGAGAAAGACCCAAAGTGGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-1024s1c1
Sequence:CCGGGCTGTCTGATTCCATCGTGAACTCGAGTTCACGATGGAATCAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173440.1-1850s1c1
Sequence:CCGGGCTGCTAATAACAGTCTGCTTCTCGAGAAGCAGACTGTTATTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-3356s1c1
Sequence:CCGGGCCGTAGATACTGCCAATCATCTCGAGATGATTGGCAGTATCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-2716s1c1
Sequence:CCGGCGGTCTGATTGATAGATTAAACTCGAGTTTAATCTATCAATCAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-2230s21c1
Sequence:CCGGCAGTTGCTGCTCGGCCATAAACTCGAGTTTATGGCCGAGCAGCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-1979s21c1
Sequence:CCGGCCGATAACAACCCGAGCTTTACTCGAGTAAAGCTCGGGTTGTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-751s21c1
Sequence:CCGGGATGTGCATCAGGATTCTATTCTCGAGAATAGAATCCTGATGCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-3855s21c1
Sequence:CCGGTAAGTGGGTCATCGCAGATATCTCGAGATATCTGCGATGACCCACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-3434s21c1
Sequence:CCGGGCAGGAATGAGCTCGATTATACTCGAGTATAATCGAGCTCATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-780s21c1
Sequence:CCGGTTACCTCGAAGGGTTACTAATCTCGAGATTAGTAACCCTTCGAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173440
VALIDATED
NRIP1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor interacting protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-4221s1c1
Sequence:CCGGGCCATACCACTTTGGGTCTTTCTCGAGAAAGACCCAAAGTGGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-1024s1c1
Sequence:CCGGGCTGTCTGATTCCATCGTGAACTCGAGTTCACGATGGAATCAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173440.1-1850s1c1
Sequence:CCGGGCTGCTAATAACAGTCTGCTTCTCGAGAAGCAGACTGTTATTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-3356s1c1
Sequence:CCGGGCCGTAGATACTGCCAATCATCTCGAGATGATTGGCAGTATCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173440.1-2716s1c1
Sequence:CCGGCGGTCTGATTGATAGATTAAACTCGAGTTTAATCTATCAATCAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-2230s21c1
Sequence:CCGGCAGTTGCTGCTCGGCCATAAACTCGAGTTTATGGCCGAGCAGCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-1979s21c1
Sequence:CCGGCCGATAACAACCCGAGCTTTACTCGAGTAAAGCTCGGGTTGTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-751s21c1
Sequence:CCGGGATGTGCATCAGGATTCTATTCTCGAGAATAGAATCCTGATGCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-3855s21c1
Sequence:CCGGTAAGTGGGTCATCGCAGATATCTCGAGATATCTGCGATGACCCACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173440.2-3434s21c1
Sequence:CCGGGCAGGAATGAGCTCGATTATACTCGAGTATAATCGAGCTCATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173440.2-780s21c1
Sequence:CCGGTTACCTCGAAGGGTTACTAATCTCGAGATTAGTAACCCTTCGAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003489
VALIDATED
NRIP1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-3432s1c1
Sequence:CCGGGCGGAGAAGAATGAGTATGAACTCGAGTTCATACTCATTCTTCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003489.1-1255s1c1
Sequence:CCGGGCCATCTTAATGGTCAGGCAACTCGAGTTGCCTGACCATTAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003489.1-2057s1c1
Sequence:CCGGGCTAACAAATACTGCATCTAACTCGAGTTAGATGCAGTATTTGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-996s1c1
Sequence:CCGGGCTGCAAGATTACAGGCTGTTCTCGAGAACAGCCTGTAATCTTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-411s1c1
Sequence:CCGGGCTGGGCATAATGAAGAGGATCTCGAGATCCTCTTCATTATGCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-2581s21c1
Sequence:CCGGACCGATAGGTATGATTGATAGCTCGAGCTATCAATCATACCTATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-655s21c1
Sequence:CCGGTTACCTAGAAGGATTACTAATCTCGAGATTAGTAATCCTTCTAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003489.3-4529s21c1
Sequence:CCGGTGCTGATTCACAGCTTATTATCTCGAGATAATAAGCTGTGAATCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-626s21c1
Sequence:CCGGGATGTGCACCAGGATTCTATTCTCGAGAATAGAATCCTGGTGCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003489.3-3743s21c1
Sequence:CCGGGCGGAGAAGAATGAGTATGAACTCGAGTTCATACTCATTCTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003489
VALIDATED
NRIP1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-3432s1c1
Sequence:CCGGGCGGAGAAGAATGAGTATGAACTCGAGTTCATACTCATTCTTCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003489.1-1255s1c1
Sequence:CCGGGCCATCTTAATGGTCAGGCAACTCGAGTTGCCTGACCATTAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003489.1-2057s1c1
Sequence:CCGGGCTAACAAATACTGCATCTAACTCGAGTTAGATGCAGTATTTGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-996s1c1
Sequence:CCGGGCTGCAAGATTACAGGCTGTTCTCGAGAACAGCCTGTAATCTTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-411s1c1
Sequence:CCGGGCTGGGCATAATGAAGAGGATCTCGAGATCCTCTTCATTATGCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-2581s21c1
Sequence:CCGGACCGATAGGTATGATTGATAGCTCGAGCTATCAATCATACCTATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-655s21c1
Sequence:CCGGTTACCTAGAAGGATTACTAATCTCGAGATTAGTAATCCTTCTAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003489.3-4529s21c1
Sequence:CCGGTGCTGATTCACAGCTTATTATCTCGAGATAATAAGCTGTGAATCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-626s21c1
Sequence:CCGGGATGTGCACCAGGATTCTATTCTCGAGAATAGAATCCTGGTGCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003489.3-3743s21c1
Sequence:CCGGGCGGAGAAGAATGAGTATGAACTCGAGTTCATACTCATTCTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003489
VALIDATED
NRIP1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-3432s1c1
Sequence:CCGGGCGGAGAAGAATGAGTATGAACTCGAGTTCATACTCATTCTTCTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003489.1-1255s1c1
Sequence:CCGGGCCATCTTAATGGTCAGGCAACTCGAGTTGCCTGACCATTAAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003489.1-2057s1c1
Sequence:CCGGGCTAACAAATACTGCATCTAACTCGAGTTAGATGCAGTATTTGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-996s1c1
Sequence:CCGGGCTGCAAGATTACAGGCTGTTCTCGAGAACAGCCTGTAATCTTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003489.1-411s1c1
Sequence:CCGGGCTGGGCATAATGAAGAGGATCTCGAGATCCTCTTCATTATGCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-2581s21c1
Sequence:CCGGACCGATAGGTATGATTGATAGCTCGAGCTATCAATCATACCTATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-655s21c1
Sequence:CCGGTTACCTAGAAGGATTACTAATCTCGAGATTAGTAATCCTTCTAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003489.3-4529s21c1
Sequence:CCGGTGCTGATTCACAGCTTATTATCTCGAGATAATAAGCTGTGAATCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003489.3-626s21c1
Sequence:CCGGGATGTGCACCAGGATTCTATTCTCGAGAATAGAATCCTGGTGCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003489.3-3743s21c1
Sequence:CCGGGCGGAGAAGAATGAGTATGAACTCGAGTTCATACTCATTCTTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)