EMAIL THIS PAGE TO A FRIEND

NRIP2

nuclear receptor interacting protein 2

52 Gene Product Result for
UniProtKB ID: Q9BQI9
Gene ID:
Mouse(60345) nuclear receptor interacting protein 2
Rat(689619) nuclear receptor interacting protein 2
Zebrafish(565865) nuclear receptor interacting protein 2
dog(486744) nuclear receptor interacting protein 2
cow(614457) nuclear receptor interacting protein 2
domestic cat(101098549) nuclear receptor interacting protein 2
sheep(101118863) nuclear receptor interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086771 MISSION® esiRNA esiRNA human NRIP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031474 Rosetta Predictions human pricing
XM_001071392 Rosetta Predictions rat pricing
NM_021717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029939 predicted 510
2 SASI_Hs01_00029940 predicted 559
3 SASI_Hs01_00029941 predicted 1143
4 SASI_Hs01_00029942 predicted 1160
5 SASI_Hs01_00029944 predicted 1110
6 SASI_Hs01_00029945 predicted 1100
7 SASI_Hs01_00029946 predicted 1228
8 SASI_Hs01_00029947 predicted 574
9 SASI_Hs01_00029948 predicted 554
10 SASI_Hs02_00358900 predicted 307
11 SASI_Hs01_00029943 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334957 predicted 548
2 SASI_Rn02_00334958 predicted 463
3 SASI_Rn02_00334959 predicted 546
4 SASI_Rn02_00334960 predicted 531
5 SASI_Rn02_00334961 predicted 467
6 SASI_Rn02_00334962 predicted 509
7 SASI_Rn02_00334963 predicted 514
8 SASI_Rn02_00334964 predicted 449
9 SASI_Rn02_00334965 predicted 511
10 SASI_Rn02_00334966 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092687 predicted 664
2 SASI_Mm01_00092688 predicted 457
3 SASI_Mm01_00092689 predicted 825
4 SASI_Mm01_00092690 predicted 536
5 SASI_Mm02_00326409 predicted 733
6 SASI_Mm01_00092691 predicted 608
7 SASI_Mm01_00092692 predicted 729
8 SASI_Mm01_00092693 predicted 697
9 SASI_Mm01_00092694 predicted 888
10 SASI_Mm01_00092696 predicted 928
11 SASI_Mm01_00092695 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031474
NRIP2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor interacting protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031474.2-486s21c1
Sequence:CCGGGATGCAGGACCTGATTCATGGCTCGAGCCATGAATCAGGTCCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031474.2-1192s21c1
Sequence:CCGGGACCACAGATAGGAACCTAAGCTCGAGCTTAGGTTCCTATCTGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031474.2-1136s21c1
Sequence:CCGGCCACGATGCCAGGATTCTGATCTCGAGATCAGAATCCTGGCATCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031474.2-770s21c1
Sequence:CCGGTGGATGCTGAGAGTCCTGAATCTCGAGATTCAGGACTCTCAGCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-561s1c1
Sequence:CCGGCCGTTGACACAGGCACCCAATCTCGAGATTGGGTGCCTGTGTCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-781s1c1
Sequence:CCGGGCTTTCTCTCAAGTGCTGCATCTCGAGATGCAGCACTTGAGAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-573s1c1
Sequence:CCGGGCACCCAATACAATCGGATCTCTCGAGAGATCCGATTGTATTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-81s1c1
Sequence:CCGGCCTGTTGGAAAGAGAGCTGCACTCGAGTGCAGCTCTCTTTCCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-500s1c1
Sequence:CCGGAGGACAGAGATTCCAGCTCTTCTCGAGAAGAGCTGGAATCTCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031474
NRIP2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor interacting protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031474.2-486s21c1
Sequence:CCGGGATGCAGGACCTGATTCATGGCTCGAGCCATGAATCAGGTCCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031474.2-1192s21c1
Sequence:CCGGGACCACAGATAGGAACCTAAGCTCGAGCTTAGGTTCCTATCTGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031474.2-1136s21c1
Sequence:CCGGCCACGATGCCAGGATTCTGATCTCGAGATCAGAATCCTGGCATCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031474.2-770s21c1
Sequence:CCGGTGGATGCTGAGAGTCCTGAATCTCGAGATTCAGGACTCTCAGCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-561s1c1
Sequence:CCGGCCGTTGACACAGGCACCCAATCTCGAGATTGGGTGCCTGTGTCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-781s1c1
Sequence:CCGGGCTTTCTCTCAAGTGCTGCATCTCGAGATGCAGCACTTGAGAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-573s1c1
Sequence:CCGGGCACCCAATACAATCGGATCTCTCGAGAGATCCGATTGTATTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-81s1c1
Sequence:CCGGCCTGTTGGAAAGAGAGCTGCACTCGAGTGCAGCTCTCTTTCCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-500s1c1
Sequence:CCGGAGGACAGAGATTCCAGCTCTTCTCGAGAAGAGCTGGAATCTCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031474
NRIP2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor interacting protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031474.2-486s21c1
Sequence:CCGGGATGCAGGACCTGATTCATGGCTCGAGCCATGAATCAGGTCCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031474.2-1192s21c1
Sequence:CCGGGACCACAGATAGGAACCTAAGCTCGAGCTTAGGTTCCTATCTGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031474.2-1136s21c1
Sequence:CCGGCCACGATGCCAGGATTCTGATCTCGAGATCAGAATCCTGGCATCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031474.2-770s21c1
Sequence:CCGGTGGATGCTGAGAGTCCTGAATCTCGAGATTCAGGACTCTCAGCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-561s1c1
Sequence:CCGGCCGTTGACACAGGCACCCAATCTCGAGATTGGGTGCCTGTGTCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-781s1c1
Sequence:CCGGGCTTTCTCTCAAGTGCTGCATCTCGAGATGCAGCACTTGAGAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-573s1c1
Sequence:CCGGGCACCCAATACAATCGGATCTCTCGAGAGATCCGATTGTATTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-81s1c1
Sequence:CCGGCCTGTTGGAAAGAGAGCTGCACTCGAGTGCAGCTCTCTTTCCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031474.1-500s1c1
Sequence:CCGGAGGACAGAGATTCCAGCTCTTCTCGAGAAGAGCTGGAATCTCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021717
VALIDATED
NRIP2 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor interacting protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021717.2-1117s21c1
Sequence:CCGGTCTGGAGACCACTGCATTAATCTCGAGATTAATGCAGTGGTCTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.1-383s21c1
Sequence:CCGGAGACTCCAGGAAAGAACAGGACTCGAGTCCTGTTCTTTCCTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.1-540s21c1
Sequence:CCGGCCACACAGTGTGATCCAAAGACTCGAGTCTTTGGATCACACTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.2-724s21c1
Sequence:CCGGGGACCCAGCACAACCAGATTTCTCGAGAAATCTGGTTGTGCTGGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021717.1-770s1c1
Sequence:CCGGGTTAGGAAAGAGGGTCCCAAACTCGAGTTTGGGACCCTCTTTCCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-932s1c1
Sequence:CCGGGCTCTCCCTCAAGTGCTGCATCTCGAGATGCAGCACTTGAGGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-816s1c1
Sequence:CCGGGAGCCACCAACTCAGGTAGAACTCGAGTTCTACCTGAGTTGGTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-383s1c1
Sequence:CCGGAGACTCCAGGAAAGAACAGGACTCGAGTCCTGTTCTTTCCTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-540s1c1
Sequence:CCGGCCACACAGTGTGATCCAAAGACTCGAGTCTTTGGATCACACTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021717
VALIDATED
NRIP2 MISSION shRNA shRNA Plasmid DNA
nuclear receptor interacting protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021717.2-1117s21c1
Sequence:CCGGTCTGGAGACCACTGCATTAATCTCGAGATTAATGCAGTGGTCTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.1-383s21c1
Sequence:CCGGAGACTCCAGGAAAGAACAGGACTCGAGTCCTGTTCTTTCCTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.1-540s21c1
Sequence:CCGGCCACACAGTGTGATCCAAAGACTCGAGTCTTTGGATCACACTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.2-724s21c1
Sequence:CCGGGGACCCAGCACAACCAGATTTCTCGAGAAATCTGGTTGTGCTGGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021717.1-770s1c1
Sequence:CCGGGTTAGGAAAGAGGGTCCCAAACTCGAGTTTGGGACCCTCTTTCCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-932s1c1
Sequence:CCGGGCTCTCCCTCAAGTGCTGCATCTCGAGATGCAGCACTTGAGGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-816s1c1
Sequence:CCGGGAGCCACCAACTCAGGTAGAACTCGAGTTCTACCTGAGTTGGTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-383s1c1
Sequence:CCGGAGACTCCAGGAAAGAACAGGACTCGAGTCCTGTTCTTTCCTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-540s1c1
Sequence:CCGGCCACACAGTGTGATCCAAAGACTCGAGTCTTTGGATCACACTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021717
VALIDATED
NRIP2 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor interacting protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021717.2-1117s21c1
Sequence:CCGGTCTGGAGACCACTGCATTAATCTCGAGATTAATGCAGTGGTCTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.1-383s21c1
Sequence:CCGGAGACTCCAGGAAAGAACAGGACTCGAGTCCTGTTCTTTCCTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.1-540s21c1
Sequence:CCGGCCACACAGTGTGATCCAAAGACTCGAGTCTTTGGATCACACTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021717.2-724s21c1
Sequence:CCGGGGACCCAGCACAACCAGATTTCTCGAGAAATCTGGTTGTGCTGGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021717.1-770s1c1
Sequence:CCGGGTTAGGAAAGAGGGTCCCAAACTCGAGTTTGGGACCCTCTTTCCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-932s1c1
Sequence:CCGGGCTCTCCCTCAAGTGCTGCATCTCGAGATGCAGCACTTGAGGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-816s1c1
Sequence:CCGGGAGCCACCAACTCAGGTAGAACTCGAGTTCTACCTGAGTTGGTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-383s1c1
Sequence:CCGGAGACTCCAGGAAAGAACAGGACTCGAGTCCTGTTCTTTCCTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021717.1-540s1c1
Sequence:CCGGCCACACAGTGTGATCCAAAGACTCGAGTCTTTGGATCACACTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)