EMAIL THIS PAGE TO A FRIEND

NRIP3

nuclear receptor interacting protein 3

95 Gene Product Result for
Synonyms: C11orf14 NY-SAR-105
UniProtKB ID: Q9NQ35, Q86WD9
Gene ID:
Mouse(78593) nuclear receptor interacting protein 3
Rat(361625) nuclear receptor interacting protein 3
sheep(101105944) nuclear receptor interacting protein 3
domestic guinea pig(100730967) nuclear receptor interacting protein 3
naked mole-rat(101699718) nuclear receptor interacting protein 3
chicken(423050) nuclear receptor interacting protein 3
cow(538608) nuclear receptor interacting protein 3
domestic cat(101085403) nuclear receptor interacting protein 3
dog(610510) nuclear receptor interacting protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024101 MISSION® esiRNA esiRNA targeting mouse Nrip3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020645 Rosetta Predictions human pricing
NM_001108498 Rosetta Predictions rat pricing
NM_020610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012944 predicted 879
2 SASI_Hs01_00012945 predicted 941
3 SASI_Hs01_00012946 predicted 439
4 SASI_Hs01_00012947 predicted 855
5 SASI_Hs01_00012948 predicted 317
6 SASI_Hs01_00012949 predicted 483
7 SASI_Hs01_00012950 predicted 765
8 SASI_Hs01_00012951 predicted 956
9 SASI_Hs01_00012952 predicted 1008
10 SASI_Hs02_00353624 predicted 544
11 SASI_Hs01_00012953 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239239 predicted 623
2 SASI_Rn02_00239240 predicted 567
3 SASI_Rn02_00239241 predicted 652
4 SASI_Rn02_00239242 predicted 498
5 SASI_Rn02_00239243 predicted 239
6 SASI_Rn02_00239244 predicted 565
7 SASI_Rn02_00239245 predicted 429
8 SASI_Rn02_00239246 predicted 666
9 SASI_Rn02_00239247 predicted 1273
10 SASI_Rn02_00239248 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325724 predicted 975
2 SASI_Mm01_00164251 predicted 431
3 SASI_Mm01_00164252 predicted 483
4 SASI_Mm01_00164253 predicted 854
5 SASI_Mm01_00164254 predicted 1055
6 SASI_Mm01_00164255 predicted 980
7 SASI_Mm01_00164257 predicted 1070
8 SASI_Mm01_00164258 predicted 958
9 SASI_Mm01_00164259 predicted 988
10 SASI_Mm01_00164260 predicted 727
11 SASI_Mm01_00164256 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020645
VALIDATED
NRIP3 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor interacting protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-447s1c1
Sequence:CCGGGCCTATATAATCTCATCTCTTCTCGAGAAGAGATGAGATTATATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-623s1c1
Sequence:CCGGGTGGTTGATGACAATGAGAAACTCGAGTTTCTCATTGTCATCAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-682s1c1
Sequence:CCGGGTGCATCATAAACTTGGATAACTCGAGTTATCCAAGTTTATGATGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020645.1-749s1c1
Sequence:CCGGGTGGAGACAGTCTCTTTGAATCTCGAGATTCAAAGAGACTGTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-231s1c1
Sequence:CCGGCCAAGGACATGCAACCTCATACTCGAGTATGAGGTTGCATGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-670s21c1
Sequence:CCGGGTGGTTGATGACAATGAGAAACTCGAGTTTCTCATTGTCATCAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-796s21c1
Sequence:CCGGGTGGAGACAGTCTCTTTGAATCTCGAGATTCAAAGAGACTGTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-278s21c1
Sequence:CCGGCCAAGGACATGCAACCTCATACTCGAGTATGAGGTTGCATGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-729s21c1
Sequence:CCGGGTGCATCATAAACTTGGATAACTCGAGTTATCCAAGTTTATGATGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020645
VALIDATED
NRIP3 MISSION shRNA shRNA Plasmid DNA
nuclear receptor interacting protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-447s1c1
Sequence:CCGGGCCTATATAATCTCATCTCTTCTCGAGAAGAGATGAGATTATATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-623s1c1
Sequence:CCGGGTGGTTGATGACAATGAGAAACTCGAGTTTCTCATTGTCATCAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-682s1c1
Sequence:CCGGGTGCATCATAAACTTGGATAACTCGAGTTATCCAAGTTTATGATGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020645.1-749s1c1
Sequence:CCGGGTGGAGACAGTCTCTTTGAATCTCGAGATTCAAAGAGACTGTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-231s1c1
Sequence:CCGGCCAAGGACATGCAACCTCATACTCGAGTATGAGGTTGCATGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-670s21c1
Sequence:CCGGGTGGTTGATGACAATGAGAAACTCGAGTTTCTCATTGTCATCAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-796s21c1
Sequence:CCGGGTGGAGACAGTCTCTTTGAATCTCGAGATTCAAAGAGACTGTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-278s21c1
Sequence:CCGGCCAAGGACATGCAACCTCATACTCGAGTATGAGGTTGCATGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-729s21c1
Sequence:CCGGGTGCATCATAAACTTGGATAACTCGAGTTATCCAAGTTTATGATGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020645
VALIDATED
NRIP3 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor interacting protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-447s1c1
Sequence:CCGGGCCTATATAATCTCATCTCTTCTCGAGAAGAGATGAGATTATATAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-623s1c1
Sequence:CCGGGTGGTTGATGACAATGAGAAACTCGAGTTTCTCATTGTCATCAACCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-682s1c1
Sequence:CCGGGTGCATCATAAACTTGGATAACTCGAGTTATCCAAGTTTATGATGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020645.1-749s1c1
Sequence:CCGGGTGGAGACAGTCTCTTTGAATCTCGAGATTCAAAGAGACTGTCTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020645.1-231s1c1
Sequence:CCGGCCAAGGACATGCAACCTCATACTCGAGTATGAGGTTGCATGTCCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-670s21c1
Sequence:CCGGGTGGTTGATGACAATGAGAAACTCGAGTTTCTCATTGTCATCAACCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-796s21c1
Sequence:CCGGGTGGAGACAGTCTCTTTGAATCTCGAGATTCAAAGAGACTGTCTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-278s21c1
Sequence:CCGGCCAAGGACATGCAACCTCATACTCGAGTATGAGGTTGCATGTCCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020645.2-729s21c1
Sequence:CCGGGTGCATCATAAACTTGGATAACTCGAGTTATCCAAGTTTATGATGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020610
NRIP3 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor interacting protein 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-777s21c1
Sequence:CCGGCAACACTTCAGAAGCATAATTCTCGAGAATTATGCTTCTGAAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-684s1c1
Sequence:CCGGGTGCATCATAAACTTGGACAACTCGAGTTGTCCAAGTTTATGATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020610.1-1249s21c1
Sequence:CCGGAGAATCTCTTCTGAAGTAATTCTCGAGAATTACTTCAGAAGAGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-1134s1c1
Sequence:CCGGGCCAGGTTCTACTTCTCCATACTCGAGTATGGAGAAGTAGAACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-2324s1c1
Sequence:CCGGCGGCAGCATTAAGAACCATTACTCGAGTAATGGTTCTTAATGCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-446s1c1
Sequence:CCGGGCTGTCAATATAATCTCATCTCTCGAGAGATGAGATTATATTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020610.1-980s21c1
Sequence:CCGGGGTTAATGGCTTAATGGTTAACTCGAGTTAACCATTAAGCCATTAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-332s1c1
Sequence:CCGGCCAACAAATTCAATCAGGCTACTCGAGTAGCCTGATTGAATTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-1581s1c1
Sequence:CCGGGCTTGTTTATTAAGAGTGCTTCTCGAGAAGCACTCTTAATAAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-774s1c1
Sequence:CCGGCGACAACACTTCAGAAGCATACTCGAGTATGCTTCTGAAGTGTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-619s1c1
Sequence:CCGGGCAGCTGTGGTTGATGATAATCTCGAGATTATCATCAACCACAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-439s21c1
Sequence:CCGGGACACTGGCTGTCAATATAATCTCGAGATTATATTGACAGCCAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-565s21c1
Sequence:CCGGGGCCAGATTGAGCACCTAATGCTCGAGCATTAGGTGCTCAATCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020610
NRIP3 MISSION shRNA shRNA Plasmid DNA
nuclear receptor interacting protein 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-777s21c1
Sequence:CCGGCAACACTTCAGAAGCATAATTCTCGAGAATTATGCTTCTGAAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-684s1c1
Sequence:CCGGGTGCATCATAAACTTGGACAACTCGAGTTGTCCAAGTTTATGATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020610.1-1249s21c1
Sequence:CCGGAGAATCTCTTCTGAAGTAATTCTCGAGAATTACTTCAGAAGAGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-1134s1c1
Sequence:CCGGGCCAGGTTCTACTTCTCCATACTCGAGTATGGAGAAGTAGAACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-2324s1c1
Sequence:CCGGCGGCAGCATTAAGAACCATTACTCGAGTAATGGTTCTTAATGCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-446s1c1
Sequence:CCGGGCTGTCAATATAATCTCATCTCTCGAGAGATGAGATTATATTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020610.1-980s21c1
Sequence:CCGGGGTTAATGGCTTAATGGTTAACTCGAGTTAACCATTAAGCCATTAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-332s1c1
Sequence:CCGGCCAACAAATTCAATCAGGCTACTCGAGTAGCCTGATTGAATTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-1581s1c1
Sequence:CCGGGCTTGTTTATTAAGAGTGCTTCTCGAGAAGCACTCTTAATAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-774s1c1
Sequence:CCGGCGACAACACTTCAGAAGCATACTCGAGTATGCTTCTGAAGTGTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-619s1c1
Sequence:CCGGGCAGCTGTGGTTGATGATAATCTCGAGATTATCATCAACCACAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-439s21c1
Sequence:CCGGGACACTGGCTGTCAATATAATCTCGAGATTATATTGACAGCCAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-565s21c1
Sequence:CCGGGGCCAGATTGAGCACCTAATGCTCGAGCATTAGGTGCTCAATCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020610
NRIP3 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor interacting protein 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-777s21c1
Sequence:CCGGCAACACTTCAGAAGCATAATTCTCGAGAATTATGCTTCTGAAGTGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-684s1c1
Sequence:CCGGGTGCATCATAAACTTGGACAACTCGAGTTGTCCAAGTTTATGATGCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020610.1-1249s21c1
Sequence:CCGGAGAATCTCTTCTGAAGTAATTCTCGAGAATTACTTCAGAAGAGATTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-1134s1c1
Sequence:CCGGGCCAGGTTCTACTTCTCCATACTCGAGTATGGAGAAGTAGAACCTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-2324s1c1
Sequence:CCGGCGGCAGCATTAAGAACCATTACTCGAGTAATGGTTCTTAATGCTGCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-446s1c1
Sequence:CCGGGCTGTCAATATAATCTCATCTCTCGAGAGATGAGATTATATTGACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020610.1-980s21c1
Sequence:CCGGGGTTAATGGCTTAATGGTTAACTCGAGTTAACCATTAAGCCATTAACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-332s1c1
Sequence:CCGGCCAACAAATTCAATCAGGCTACTCGAGTAGCCTGATTGAATTTGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020610.1-1581s1c1
Sequence:CCGGGCTTGTTTATTAAGAGTGCTTCTCGAGAAGCACTCTTAATAAACAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-774s1c1
Sequence:CCGGCGACAACACTTCAGAAGCATACTCGAGTATGCTTCTGAAGTGTTGTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020610.1-619s1c1
Sequence:CCGGGCAGCTGTGGTTGATGATAATCTCGAGATTATCATCAACCACAGCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-439s21c1
Sequence:CCGGGACACTGGCTGTCAATATAATCTCGAGATTATATTGACAGCCAGTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020610.1-565s21c1
Sequence:CCGGGGCCAGATTGAGCACCTAATGCTCGAGCATTAGGTGCTCAATCTGGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???