EMAIL THIS PAGE TO A FRIEND

NRK

Nik related kinase

233 Gene Product Result for
Synonyms: NESK
UniProtKB ID: Q7Z2Y5, Q32ND6, Q5H9K2, Q6ZMP2
Gene ID:
Human(203447) Summary: The mouse ortholog of this gene encodes a protein kinase required for JNK activation. The encoded protein may be involved in the induction of actin polymerization in late embryogenesis.[provided by RefSeq, Jun 2010]
Mouse(27206) Nik related kinase
Rat(315907) Nik related kinase
fruit fly(36445) Neurospecific receptor kinase
cow(783774) Nik related kinase
cow(100336665) Nik related kinase
domestic cat(101100286) Nik related kinase
dog(492047) Nik related kinase
chicken(422380) Nik related kinase
naked mole-rat(101700495) Nik related kinase
domestic guinea pig(100725909) Nik related kinase
sheep(101102458) Nik related kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198465 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046931 MISSION® esiRNA esiRNA targeting mouse Nrk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198465 Rosetta Predictions human pricing
XM_001055951 Rosetta Predictions rat pricing
XM_236524 Rosetta Predictions rat pricing
NM_013724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194093 predicted 2044
2 SASI_Hs01_00194095 predicted 838
3 SASI_Hs01_00194096 predicted 2197
4 SASI_Hs02_00371993 predicted 4334
5 SASI_Hs01_00194097 predicted 2095
6 SASI_Hs01_00194098 predicted 4398
7 SASI_Hs01_00194099 predicted 2763
8 SASI_Hs01_00194100 predicted 773
9 SASI_Hs01_00194101 predicted 4797
10 SASI_Hs02_00371994 predicted 1693
11 SASI_Hs01_00194094 predicted 1871
12 SASI_Hs01_00194102 predicted 3934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281559 predicted 4274
2 SASI_Rn02_00281560 predicted 4144
3 SASI_Rn02_00281561 predicted 2863
4 SASI_Rn02_00281562 predicted 3199
5 SASI_Rn02_00281563 predicted 1651
6 SASI_Rn02_00281564 predicted 3151
7 SASI_Rn02_00281565 predicted 916
8 SASI_Rn02_00281566 predicted 658
9 SASI_Rn02_00281567 predicted 713
10 SASI_Rn02_00281568 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390119 predicted 624
2 SASI_Rn02_00390120 predicted 2263
3 SASI_Rn02_00390121 predicted 710
4 SASI_Rn02_00390122 predicted 2596
5 SASI_Rn02_00390123 predicted 1048
6 SASI_Rn02_00390124 predicted 2547
7 SASI_Rn02_00390125 predicted 2221
8 SASI_Rn02_00390126 predicted 318
9 SASI_Rn02_00390127 predicted 2663
10 SASI_Rn02_00390128 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076841 predicted 384
2 SASI_Mm01_00076843 predicted 4412
3 SASI_Mm02_00322642 predicted 878
4 SASI_Mm01_00076844 predicted 3718
5 SASI_Mm01_00076845 predicted 308
6 SASI_Mm01_00076846 predicted 3100
7 SASI_Mm02_00322643 predicted 942
8 SASI_Mm01_00076847 predicted 347
9 SASI_Mm01_00076848 predicted 3817
10 SASI_Mm02_00322644 predicted 3767
11 SASI_Mm01_00076842 predicted 4240
12 SASI_Mm01_00076849 predicted 3747
13 SASI_Mm01_00076850 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013724
NRK MISSION shRNA Bacterial Glycerol Stock
Nik related kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013724.2-2870s21c1
Sequence:CCGGTCACCGCCTTATTCTACTATTCTCGAGAATAGTAGAATAAGGCGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013724.2-5082s21c1
Sequence:CCGGCCAAGTGAAGGTTAGATTAAACTCGAGTTTAATCTAACCTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013724.2-410s21c1
Sequence:CCGGGCCATTGGTCTTGGTACTTATCTCGAGATAAGTACCAAGACCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-709s1c1
Sequence:CCGGCGCTTATATCTGTCGAGAAATCTCGAGATTTCTCGACAGATATAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-4234s1c1
Sequence:CCGGGCCAAATAATAATGTCGTCATCTCGAGATGACGACATTATTATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-3443s1c1
Sequence:CCGGCCAGAGTTTGAACATGAGGAACTCGAGTTCCTCATGTTCAAACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-613s1c1
Sequence:CCGGGCACCAACTTTGGATGGTAATCTCGAGATTACCATCCAAAGTTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-2798s1c1
Sequence:CCGGCCGCCTTATTCTACTATTGATCTCGAGATCAATAGTAGAATAAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013724
NRK MISSION shRNA shRNA Plasmid DNA
Nik related kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013724.2-2870s21c1
Sequence:CCGGTCACCGCCTTATTCTACTATTCTCGAGAATAGTAGAATAAGGCGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013724.2-5082s21c1
Sequence:CCGGCCAAGTGAAGGTTAGATTAAACTCGAGTTTAATCTAACCTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013724.2-410s21c1
Sequence:CCGGGCCATTGGTCTTGGTACTTATCTCGAGATAAGTACCAAGACCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-709s1c1
Sequence:CCGGCGCTTATATCTGTCGAGAAATCTCGAGATTTCTCGACAGATATAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-4234s1c1
Sequence:CCGGGCCAAATAATAATGTCGTCATCTCGAGATGACGACATTATTATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-3443s1c1
Sequence:CCGGCCAGAGTTTGAACATGAGGAACTCGAGTTCCTCATGTTCAAACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-613s1c1
Sequence:CCGGGCACCAACTTTGGATGGTAATCTCGAGATTACCATCCAAAGTTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-2798s1c1
Sequence:CCGGCCGCCTTATTCTACTATTGATCTCGAGATCAATAGTAGAATAAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013724
NRK MISSION shRNA Lentiviral Transduction Particles
Nik related kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013724.2-2870s21c1
Sequence:CCGGTCACCGCCTTATTCTACTATTCTCGAGAATAGTAGAATAAGGCGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013724.2-5082s21c1
Sequence:CCGGCCAAGTGAAGGTTAGATTAAACTCGAGTTTAATCTAACCTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013724.2-410s21c1
Sequence:CCGGGCCATTGGTCTTGGTACTTATCTCGAGATAAGTACCAAGACCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-709s1c1
Sequence:CCGGCGCTTATATCTGTCGAGAAATCTCGAGATTTCTCGACAGATATAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-4234s1c1
Sequence:CCGGGCCAAATAATAATGTCGTCATCTCGAGATGACGACATTATTATTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-3443s1c1
Sequence:CCGGCCAGAGTTTGAACATGAGGAACTCGAGTTCCTCATGTTCAAACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-613s1c1
Sequence:CCGGGCACCAACTTTGGATGGTAATCTCGAGATTACCATCCAAAGTTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013724.1-2798s1c1
Sequence:CCGGCCGCCTTATTCTACTATTGATCTCGAGATCAATAGTAGAATAAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198465
NRK MISSION shRNA Bacterial Glycerol Stock
Nik related kinase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-2037s1c1
Sequence:CCGGCCTGAGTCATTACGAGTAAATCTCGAGATTTACTCGTAATGACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-3444s1c1
Sequence:CCGGGCAGCCAATATAGGCAGTGAACTCGAGTTCACTGCCTATATTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-712s1c1
Sequence:CCGGCGGTCACTGATGTAGTGAGAACTCGAGTTCTCACTACATCAGTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-966s1c1
Sequence:CCGGCCTGAGGTGATTGACTGTGATCTCGAGATCACAGTCAATCACCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-2254s1c1
Sequence:CCGGCGCCAAACTCAAATAACTCAACTCGAGTTGAGTTATTTGAGTTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-7198s1c1
Sequence:CCGGGAGATCGAAATGTTAGGTAATCTCGAGATTACCTAACATTTCGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198465.1-394s1c1
Sequence:CCGGCCATTGGCCTTGGTACTTATGCTCGAGCATAAGTACCAAGGCCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-1263s1c1
Sequence:CCGGCGACATGTTGTTGAGTCATTACTCGAGTAATGACTCAACAACATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-1683s1c1
Sequence:CCGGCCTCTACAAATGCAGATTAAGCTCGAGCTTAATCTGCATTTGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-6369s1c1
Sequence:CCGGCCACAAAGTATACCTCAATATCTCGAGATATTGAGGTATACTTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-5857s1c1
Sequence:CCGGCCTTAAGGTAGGCGTCAAATTCTCGAGAATTTGACGCCTACCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198465
NRK MISSION shRNA shRNA Plasmid DNA
Nik related kinase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-2037s1c1
Sequence:CCGGCCTGAGTCATTACGAGTAAATCTCGAGATTTACTCGTAATGACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-3444s1c1
Sequence:CCGGGCAGCCAATATAGGCAGTGAACTCGAGTTCACTGCCTATATTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-712s1c1
Sequence:CCGGCGGTCACTGATGTAGTGAGAACTCGAGTTCTCACTACATCAGTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-966s1c1
Sequence:CCGGCCTGAGGTGATTGACTGTGATCTCGAGATCACAGTCAATCACCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-2254s1c1
Sequence:CCGGCGCCAAACTCAAATAACTCAACTCGAGTTGAGTTATTTGAGTTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-7198s1c1
Sequence:CCGGGAGATCGAAATGTTAGGTAATCTCGAGATTACCTAACATTTCGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198465.1-394s1c1
Sequence:CCGGCCATTGGCCTTGGTACTTATGCTCGAGCATAAGTACCAAGGCCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-1263s1c1
Sequence:CCGGCGACATGTTGTTGAGTCATTACTCGAGTAATGACTCAACAACATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-1683s1c1
Sequence:CCGGCCTCTACAAATGCAGATTAAGCTCGAGCTTAATCTGCATTTGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-6369s1c1
Sequence:CCGGCCACAAAGTATACCTCAATATCTCGAGATATTGAGGTATACTTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-5857s1c1
Sequence:CCGGCCTTAAGGTAGGCGTCAAATTCTCGAGAATTTGACGCCTACCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198465
NRK MISSION shRNA Lentiviral Transduction Particles
Nik related kinase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-2037s1c1
Sequence:CCGGCCTGAGTCATTACGAGTAAATCTCGAGATTTACTCGTAATGACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-3444s1c1
Sequence:CCGGGCAGCCAATATAGGCAGTGAACTCGAGTTCACTGCCTATATTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-712s1c1
Sequence:CCGGCGGTCACTGATGTAGTGAGAACTCGAGTTCTCACTACATCAGTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-966s1c1
Sequence:CCGGCCTGAGGTGATTGACTGTGATCTCGAGATCACAGTCAATCACCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-2254s1c1
Sequence:CCGGCGCCAAACTCAAATAACTCAACTCGAGTTGAGTTATTTGAGTTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-7198s1c1
Sequence:CCGGGAGATCGAAATGTTAGGTAATCTCGAGATTACCTAACATTTCGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198465.1-394s1c1
Sequence:CCGGCCATTGGCCTTGGTACTTATGCTCGAGCATAAGTACCAAGGCCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-1263s1c1
Sequence:CCGGCGACATGTTGTTGAGTCATTACTCGAGTAATGACTCAACAACATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198465.1-1683s1c1
Sequence:CCGGCCTCTACAAATGCAGATTAAGCTCGAGCTTAATCTGCATTTGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-6369s1c1
Sequence:CCGGCCACAAAGTATACCTCAATATCTCGAGATATTGAGGTATACTTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198465.1-5857s1c1
Sequence:CCGGCCTTAAGGTAGGCGTCAAATTCTCGAGAATTTGACGCCTACCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)